Incidental Mutations

67 incidental mutations are currently displayed, and affect 66 genes.
12 are Possibly Damaging.
14 are Probably Damaging.
25 are Probably Benign.
13 are Probably Null.
5 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 67 of 67] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 565649 UTSW 4930433I11Rik 0.068 R7318 G1 225.01 Y 7 40993687 L260S T C missense Het probably benign 0.037 0.090 06/26/2019
2 565638 UTSW 9130230L23Rik 0.160 R7318 G1 225.01 Y 5 65988428 S113R A T missense Het unknown 06/26/2019
3 565676 UTSW Abcc5 0.000 R7318 G1 225.01 Y 16 20392543 P557S G A missense Het probably benign 0.007 phenotype 06/26/2019
4 565660 UTSW Acad11 0.173 R7318 G1 225.01 Y 9 104081267 T245A A G missense Het probably damaging 1.000 phenotype 06/26/2019
5 565677 UTSW Acap2 0.172 R7318 G1 225.01 Y 16 31127337 F263L A G missense Het probably damaging 1.000 06/26/2019
6 565639 UTSW Ankle2 0.948 R7318 G1 225.01 Y 5 110237766 N327I A T missense Het probably benign 0.195 phenotype 06/26/2019
7 565673 UTSW Appl1 0.338 R7318 G1 225.01 Y 14 26963660 E67G T C missense Het probably benign 0.010 phenotype 06/26/2019
8 565662 UTSW Arfgef3 0.197 R7318 G1 225.01 Y 10 18630463 C864S A T missense Het possibly damaging 0.887 0.462 phenotype 06/26/2019
9 565659 UTSW Arhgap20 0.412 R7318 G1 225.01 Y 9 51840502 I418V A G missense Het probably benign 0.000 0.090 phenotype 06/26/2019
10 565629 UTSW Arhgef2 0.751 R7318 G1 225.01 Y 3 88632303 N102Y A T missense Het probably damaging 0.982 0.149 phenotype 06/26/2019
11 565634 UTSW Car9 0.000 R7318 G1 225.01 Y 4 43513089 E431D G T missense Het probably damaging 0.987 phenotype 06/26/2019
12 565626 UTSW Cbfa2t2 0.628 R7318 G1 225.01 Y 2 154500454 I30T T C missense Het probably benign 0.014 phenotype 06/26/2019
13 565627 UTSW Cd40 0.000 R7318 G1 225.01 Y 2 165062335 D34V A T missense Het possibly damaging 0.513 phenotype 06/26/2019
14 565630 UTSW Chrnb2 0.431 R7318 G1 225.01 Y 3 89763367 T A critical splice acceptor site Het probably null 0.949 phenotype 06/26/2019
15 565650 UTSW Chsy1 0.000 R7318 G1 125.01 Y 7 66110229 T G critical splice donor site 2 bp Het probably null 0.950 phenotype 06/26/2019
16 565674 UTSW Cpne6 0.517 R7318 G1 225.01 Y 14 55514294 T245A A G missense Het possibly damaging 0.954 0.261 phenotype 06/26/2019
17 565675 UTSW Cpsf1 0.970 R7318 G1 225.01 Y 15 76597275 K1159* T A nonsense Het probably null phenotype 06/26/2019
18 565682 UTSW Crisp1 0.000 R7318 G1 225.01 Y 17 40307777 E64D T A missense Het possibly damaging 0.912 0.155 phenotype 06/26/2019
19 596091 UTSW D3Ertd751e 0.101 R7318 G1 115.01 Y 3 41802551 A G splice site Het probably null 0.976 11/18/2019
20 565622 UTSW Dnah7b 0.114 R7318 G1 225.01 Y 1 46195372 L1488Q T A missense Het probably damaging 1.000 0.487 06/26/2019
21 565658 UTSW Dnm2 1.000 R7318 G1 225.01 Y 9 21505567 G799R G A missense Het possibly damaging 0.461 phenotype 06/26/2019
22 565642 UTSW E330009J07Rik 0.090 R7318 G1 225.01 Y 6 40409164 V333A A G missense Het possibly damaging 0.719 06/26/2019
23 565684 UTSW Elp2 0.957 R7318 G1 225.01 Y 18 24606899 V61I G A missense Het probably damaging 1.000 phenotype 06/26/2019
24 565683 UTSW Epb41l3 0.000 R7318 G1 225.01 Y 17 69266140 L388P T C missense Het 0.362 phenotype 06/26/2019
25 565643 UTSW Fam19a1 0.000 R7318 G1 225.01 Y 6 96115756 T C critical splice donor site 2 bp Het probably null 0.949 phenotype 06/26/2019
26 565633 UTSW Fam205c 0.058 R7318 G1 144.46 Y 4 42871823 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG small deletion Het probably benign 0.090 06/26/2019
27 565640 UTSW Fry 0.599 R7318 G1 225.01 Y 5 150436993 S2035C A T missense Het probably damaging 0.977 0.073 06/26/2019
28 565656 UTSW Gas8 0.333 R7318 G1 225.01 Y 8 123530968 F385L T C missense Het probably benign 0.000 phenotype 06/26/2019
29 565628 UTSW Ghsr 0.000 R7318 G1 225.01 Y 3 27372467 V224A T C missense Het possibly damaging 0.912 0.657 phenotype 06/26/2019
30 565685 UTSW Gstp2 0.404 R7318 G1 225.01 Y 19 4041065 R85W T A missense Het probably benign 0.002 phenotype 06/26/2019
31 565670 UTSW Ighv1-20 0.384 R7318 G1 225.01 Y 12 114724190 I6F T A missense Het possibly damaging 0.928 06/26/2019
32 565654 UTSW Inpp4b 0.399 R7318 G1 225.01 Y 8 82071745 M854K T A missense Het probably damaging 1.000 0.800 phenotype 06/26/2019
33 565661 UTSW Kif15 0.000 R7318 G1 225.01 Y 9 122987949 E538G A G missense Het probably damaging 1.000 06/26/2019
34 565625 UTSW Large2 0.000 R7318 G1 225.01 Y 2 92366028 T485A T C missense Het probably benign 0.000 0.090 phenotype 06/26/2019
35 565647 UTSW Lmo3 0.809 R7318 G1 208.01 Y 6 138421365 T A intron Het probably benign phenotype 06/26/2019
36 565621 UTSW Lyg1 0.059 R7318 G1 225.01 Y 1 37949855 P95S G A missense Het probably benign 0.439 06/26/2019
37 565671 UTSW Lyst 0.300 R7318 G1 225.01 Y 13 13757443 H3552R A G missense Het probably benign 0.130 phenotype 06/26/2019
38 565665 UTSW Mtif2 0.963 R7318 G1 225.01 Y 11 29540115 S385L C T missense Het probably benign 0.252 phenotype 06/26/2019
39 565678 UTSW Muc4 0.110 R7318 G1 225.01 Y 16 32755336 I1737F A T missense Het unknown phenotype 06/26/2019
40 565646 UTSW Mug1 0.000 R7318 G1 225.01 Y 6 121870652 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
41 565679 UTSW Mx1 0.000 R7318 G1 225.01 Y 16 97452086 Q350K G T missense Het probably benign 0.058 phenotype 06/26/2019
42 565655 UTSW Mylk3 0.211 R7318 G1 225.01 Y 8 85359097 D269E G T missense Het probably benign 0.000 0.090 phenotype 06/26/2019
43 565624 UTSW Myo3a 0.000 R7318 G1 225.01 Y 2 22558320 K974* A T nonsense Het probably null 0.975 phenotype 06/26/2019
44 565623 UTSW Nectin4 0.105 R7318 G1 225.01 Y 1 171380463 R141L G T missense Het probably benign 0.159 phenotype 06/26/2019
45 565667 UTSW Nlgn2 0.000 R7318 G1 225.01 Y 11 69825969 H582R T C missense Het probably damaging 1.000 phenotype 06/26/2019
46 565651 UTSW Olfr558 0.084 R7318 G1 225.01 Y 7 102710019 Y253* T A nonsense Het probably null 0.972 phenotype 06/26/2019
47 565652 UTSW Olfr613 0.062 R7318 G1 225.01 Y 7 103552091 M102K T A missense Het probably damaging 0.975 0.647 phenotype 06/26/2019
48 565680 UTSW Pi16 0.060 R7318 G1 225.01 Y 17 29319234 P7Q C A missense Het possibly damaging 0.834 0.179 phenotype 06/26/2019
49 565668 UTSW Psmd11 0.967 R7318 G1 225.01 Y 11 80456302 L171I C A missense Het probably benign 0.293 0.569 phenotype 06/26/2019
50 565635 UTSW Rad54l 0.000 R7318 G1 225.01 Y 4 116110709 V152A A G missense Het possibly damaging 0.911 phenotype 06/26/2019
51 565663 UTSW Ranbp2 1.000 R7318 G1 225.01 Y 10 58483087 Y2473* T A nonsense Het probably null phenotype 06/26/2019
52 565648 UTSW Sertad1 0.380 R7318 G1 225.01 Y 7 27489485 I77T T C missense Het possibly damaging 0.860 0.335 phenotype 06/26/2019
53 565657 UTSW Sesn3 0.000 R7318 G1 225.01 Y 9 14308577 E87D A T missense Het probably damaging 0.960 phenotype 06/26/2019
54 565672 UTSW Slc30a5 0.513 R7318 G1 225.01 Y 13 100813969 S260R A T missense Het probably benign 0.128 phenotype 06/26/2019
55 565644 UTSW Slc6a12 0.000 R7318 G1 225.01 Y 6 121352013 G111S G A missense Het probably damaging 0.991 phenotype 06/26/2019
56 565645 UTSW Slc6a12 0.000 R7318 G1 225.01 Y 6 121352019 Y113H T C missense Het probably benign 0.260 phenotype 06/26/2019
57 565631 UTSW Spag17 0.000 R7318 G1 225.01 Y 3 99939983 M76R T G missense Het probably benign 0.002 0.090 phenotype 06/26/2019
58 565641 UTSW Stard13 0.000 R7318 G1 225.01 Y 5 151062573 Q491* G A nonsense Het probably null 0.975 phenotype 06/26/2019
59 565632 UTSW Synpo2 1.000 R7318 G1 225.01 Y 3 123117319 S226G T C missense Het probably benign 0.000 06/26/2019
60 565637 UTSW Tada2b 0.953 R7318 G1 191.01 Y 5 36483987 T24I G A missense Het probably benign 0.000 0.105 phenotype 06/26/2019
61 565636 UTSW Tmem51 0.000 R7318 G1 135.47 Y 4 142037685 TCCCC TCCC frame shift Het probably null 0.976 06/26/2019
62 596092 UTSW Tnnt1 0.215 R7318 G1 124.01 Y 7 4510548 T A intron Het probably null phenotype 11/18/2019
63 565653 UTSW Usp17lb 0.189 R7318 G1 225.01 Y 7 104841133 I196V T C missense Het probably benign 0.030 0.168 06/26/2019
64 565664 UTSW Utp20 0.959 R7318 G1 225.01 Y 10 88813949 K466N T A missense Het possibly damaging 0.895 phenotype 06/26/2019
65 565681 UTSW Wdr46 0.968 R7318 G1 225.01 Y 17 33941885 T C critical splice donor site 2 bp Het probably null 06/26/2019
66 565666 UTSW Zfp287 0.000 R7318 G1 225.01 Y 11 62714278 Q601L T A missense Het probably damaging 0.999 phenotype 06/26/2019
67 565669 UTSW Zfp410 0.275 R7318 G1 225.01 Y 12 84325690 S97P T C missense Het probably benign 0.005 06/26/2019
[records 1 to 67 of 67]