Incidental Mutations

80 incidental mutations are currently displayed, and affect 77 genes.
21 are Possibly Damaging.
26 are Probably Damaging.
23 are Probably Benign.
8 are Probably Null.
6 create premature stop codons.
1 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 80 of 80] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 570385 UTSW Abra 0.272 R7348 G1 225.01 Y 15 41866159 R282C G A missense Het probably damaging 0.998 0.472 phenotype 09/13/2019
2 570378 UTSW Adcy2 0.000 R7348 G1 225.01 Y 13 68734675 E314D T A missense Het possibly damaging 0.788 0.165 phenotype 09/13/2019
3 570333 UTSW Adgrl2 1.000 R7348 G1 225.01 Y 3 148817766 I274N A T missense Het 0.794 phenotype 09/13/2019
4 570363 UTSW Adpgk 0.000 R7348 G1 225.01 Y 9 59313786 I292V A G missense Het probably benign 0.001 0.101 phenotype 09/13/2019
5 570340 UTSW Agtrap 0.147 R7348 G1 225.01 Y 4 148080597 F124L G T missense Het probably benign 0.001 0.090 phenotype 09/13/2019
6 570346 UTSW Ankrd26 0.219 R7348 G1 225.01 Y 6 118508564 Y1450H A G missense Het probably damaging 1.000 phenotype 09/13/2019
7 570322 UTSW Ap4e1 0.188 R7348 G1 225.01 Y 2 127061976 S933C A T missense Het probably damaging 0.961 phenotype 09/13/2019
8 570323 UTSW Ap4e1 0.188 R7348 G1 225.01 Y 2 127061977 S933I G T missense Het possibly damaging 0.765 phenotype 09/13/2019
9 570326 UTSW Ap5s1 0.062 R7348 G1 225.01 Y 2 131212652 T128S A T missense Het possibly damaging 0.584 09/13/2019
10 570364 UTSW Arih1 0.906 R7348 G1 225.01 Y 9 59486058 Y97C T C missense Het probably damaging 0.978 0.153 09/13/2019
11 570351 UTSW Atp1a3 1.000 R7348 G1 225.01 Y 7 24978826 F1034S A G missense Het unknown phenotype 09/13/2019
12 570377 UTSW Bmp6 0.000 R7348 G1 225.01 Y 13 38485903 S388P T C missense Het probably benign 0.002 0.059 phenotype 09/13/2019
13 570331 UTSW Ccdc39 0.586 R7348 G1 225.01 Y 3 33832676 V261A A G missense Het possibly damaging 0.551 phenotype 09/13/2019
14 570382 UTSW Ccdc66 0.144 R7348 G1 225.01 Y 14 27500336 C150Y C T missense Het probably damaging 0.998 phenotype 09/13/2019
15 590962 UTSW Cep89 0.171 R7348 G1 225.01 Y 7 35429928 R630H G A missense Het probably damaging 0.969 0.647 10/25/2019
16 570365 UTSW Cln6 0.000 R7348 G1 225.01 Y 9 62849176 S201G A G missense Het probably benign 0.139 0.061 phenotype 09/13/2019
17 570360 UTSW Cntnap4 0.085 R7348 G1 225.01 Y 8 112665277 Y125H T C missense Het probably damaging 1.000 phenotype 09/13/2019
18 570319 UTSW Copa 0.970 R7348 G1 225.01 Y 1 172102223 T286A A G missense Het possibly damaging 0.956 phenotype 09/13/2019
19 570389 UTSW Cul9 0.296 R7348 G1 225.01 Y 17 46510993 I1852K A T missense Het possibly damaging 0.893 0.365 phenotype 09/13/2019
20 570336 UTSW Cyp2j8 0.074 R7348 G1 225.01 Y 4 96444640 A490S C A missense Het probably benign 0.004 09/13/2019
21 570353 UTSW Cyp2t4 0.095 R7348 G1 225.01 Y 7 27157251 I239V A G missense Het probably benign 0.015 09/13/2019
22 570371 UTSW E2f7 0.243 R7348 G1 225.01 Y 10 110780975 T692I C T missense Het probably damaging 0.980 phenotype 09/13/2019
23 570324 UTSW Fastkd5 0.757 R7348 G1 225.01 Y 2 130615135 Y512H A G missense Het probably damaging 0.999 09/13/2019
24 570325 UTSW Fastkd5 0.757 R7348 G1 225.01 Y 2 130616439 M77R A C missense Het probably benign 0.001 09/13/2019
25 570392 UTSW Fhod3 1.000 R7348 G1 225.01 N 18 25090467 R957G A G missense Het possibly damaging 0.798 phenotype 09/13/2019
26 570396 UTSW Gm17018 0.308 R7348 G1 225.01 Y 19 45572466 Y111C A G missense Het probably damaging 1.000 0.645 09/13/2019
27 570341 UTSW H6pd 0.136 R7348 G1 186.01 Y 4 149983902 C A critical splice donor site 1 bp Het probably null 0.959 phenotype 09/13/2019
28 570354 UTSW Haus5 0.944 R7348 G1 225.01 Y 7 30656966 P544Q G T missense Het possibly damaging 0.939 phenotype 09/13/2019
29 570320 UTSW Ifi207 0.082 R7348 G1 108.47 Y 1 173729196 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG small deletion Het probably benign 0.090 09/13/2019
30 570388 UTSW Igf2r 0.926 R7348 G1 225.01 Y 17 12703484 Y1248H A G missense Het probably damaging 0.994 0.568 phenotype 09/13/2019
31 570335 UTSW Izumo3 0.067 R7348 G1 225.01 Y 4 92147218 N6S T C missense Het possibly damaging 0.707 09/13/2019
32 570347 UTSW Lrp6 0.965 R7348 G1 158.01 Y 6 134450818 P1604T G T missense Het probably damaging 1.000 0.147 phenotype 09/13/2019
33 570391 UTSW Map3k8 0.000 R7348 G1 225.01 Y 18 4340561 H251L T A missense Het probably damaging 1.000 phenotype 09/13/2019
34 570342 UTSW Mapre3 0.771 R7348 G1 225.01 Y 5 30861829 Y6H T C missense Het probably benign 0.046 0.109 phenotype 09/13/2019
35 570376 UTSW Mlh3 0.000 R7348 G1 225.01 Y 12 85267441 P657Q G T missense Het probably damaging 0.994 phenotype 09/13/2019
36 570355 UTSW Mrgpra1 0.053 R7348 G1 225.01 Y 7 47335409 Y174C T C missense Het probably benign 0.093 09/13/2019
37 570394 UTSW Ms4a6d 0.064 R7348 G1 225.01 Y 19 11590073 Q155* G A nonsense Het probably null 0.976 phenotype 09/13/2019
38 570373 UTSW Myh1 0.000 R7348 G1 225.01 Y 11 67202539 P152Q C A missense Het probably damaging 0.995 0.711 phenotype 09/13/2019
39 570384 UTSW Myh6 1.000 R7348 G1 225.01 Y 14 54952259 L1110Q A T missense Het probably damaging 0.996 phenotype 09/13/2019
40 570374 UTSW Nf1 1.000 R7348 G1 225.01 Y 11 79536850 S1778T T A missense Het probably benign 0.000 0.114 phenotype 09/13/2019
41 570349 UTSW Nkpd1 0.087 R7348 G1 225.01 Y 7 19524416 E707K G A missense Het probably damaging 0.991 09/13/2019
42 570352 UTSW Nlrp4a 0.057 R7348 G1 225.01 Y 7 26444273 E21G A G missense Het probably damaging 1.000 09/13/2019
43 570334 UTSW Nr4a3 1.000 R7348 G1 225.01 Y 4 48051290 S15A T G missense Het possibly damaging 0.945 phenotype 09/13/2019
44 570369 UTSW Olfr1354 0.309 R7348 G1 225.01 Y 10 78917562 T241A A G missense Het probably damaging 0.999 0.647 phenotype 09/13/2019
45 570344 UTSW Olfr453 0.114 R7348 G1 225.01 Y 6 42744856 L273S T C missense Het possibly damaging 0.951 phenotype 09/13/2019
46 570357 UTSW Olfr488 0.232 R7348 G1 225.01 Y 7 108256123 D5G T C missense Het probably benign 0.000 0.090 phenotype 09/13/2019
47 570358 UTSW Olfr491 0.086 R7348 G1 225.01 Y 7 108317713 V273A T C missense Het possibly damaging 0.585 phenotype 09/13/2019
48 570383 UTSW Parg 1.000 R7348 G1 225.01 Y 14 32250079 R677Q G A missense Het possibly damaging 0.819 phenotype 09/13/2019
49 570395 UTSW Pcsk5 1.000 R7348 G1 225.01 Y 19 17456818 C1395* A T nonsense Het probably null phenotype 09/13/2019
50 570393 UTSW Psd2 0.000 R7348 G1 225.01 Y 18 35980336 S287N G A missense Het possibly damaging 0.845 09/13/2019
51 570359 UTSW Psd3 0.103 R7348 G1 225.01 Y 8 67790931 N685S T C missense Het possibly damaging 0.651 0.066 09/13/2019
52 570328 UTSW Pygb 0.198 R7348 G1 225.01 Y 2 150786983 T39M C T missense Het probably benign 0.102 phenotype 09/13/2019
53 570386 UTSW Rbfox1 1.000 R7348 G1 225.01 Y 16 7408024 Y351* C A nonsense Het probably null phenotype 09/13/2019
54 570390 UTSW Rftn1 0.084 R7348 G1 225.01 Y 17 50004323 L396P A G missense Het probably damaging 1.000 phenotype 09/13/2019
55 570332 UTSW S1pr1 1.000 R7348 G1 225.01 Y 3 115712061 Y295H A G missense Het probably damaging 0.999 0.354 phenotype 09/13/2019
56 570366 UTSW Scn5a 1.000 R7348 G1 225.01 Y 9 119535833 M440V T C missense Het probably benign 0.001 phenotype 09/13/2019
57 570327 UTSW Sel1l2 0.442 R7348 G1 225.01 Y 2 140265724 N240S T C missense Het probably benign 0.000 09/13/2019
58 570337 UTSW Skint1 0.112 R7348 G1 225.01 Y 4 112021573 L234P T C missense Het probably damaging 1.000 phenotype 09/13/2019
59 570338 UTSW Skint11 0.072 R7348 G1 225.01 Y 4 114244722 Y311N T A missense Het probably benign 0.148 09/13/2019
60 570356 UTSW Slc6a5 1.000 R7348 G1 105.01 Y 7 49910167 A T unclassified Het probably benign 0.090 phenotype 09/13/2019
61 570321 UTSW Tas2r134 0.054 R7348 G1 225.01 Y 2 51628402 S298P T C missense Het possibly damaging 0.921 09/13/2019
62 570375 UTSW Tbcd 0.966 R7348 G1 225.01 Y 11 121594311 A773D C A missense Het probably benign 0.221 phenotype 09/13/2019
63 570345 UTSW Tgoln1 0.116 R7348 G1 225.01 Y 6 72616278 T73R G C missense Het probably benign 0.030 09/13/2019
64 570343 UTSW Tmem184a 0.185 R7348 G1 225.01 Y 5 139814054 E24G T C missense Het probably null 0.119 09/13/2019
65 570387 UTSW Tmem207 0.051 R7348 G1 225.01 Y 16 26516827 W53C C A missense Het possibly damaging 0.677 09/13/2019
66 570318 UTSW Tns1 0.453 R7348 G1 225.01 Y 1 73916917 H549L T A missense Het possibly damaging 0.955 phenotype 09/13/2019
67 570379 UTSW Ttc37 0.441 R7348 G1 225.01 Y 13 76182884 F1478L T C missense Het possibly damaging 0.820 0.110 phenotype 09/13/2019
68 570370 UTSW Ttc41 0.132 R7348 G1 225.01 Y 10 86750348 E839* G T nonsense Het probably null 0.976 09/13/2019
69 590963 UTSW Ufd1 0.000 R7348 G1 225.01 Y 16 18815885 T G intron Het probably benign phenotype 10/25/2019
70 570362 UTSW Usp28 0.000 R7348 G1 225.01 Y 9 49030877 E713G A G missense Het probably benign 0.187 phenotype 09/13/2019
71 570368 UTSW Utrn 0.000 R7348 G1 225.01 Y 10 12748018 W159R A G missense Het probably damaging 1.000 phenotype 09/13/2019
72 570380 UTSW Vcl 1.000 R7348 G1 225.01 Y 14 21003150 A411V C T missense Het probably benign 0.000 phenotype 09/13/2019
73 570381 UTSW Vcl 1.000 R7348 G1 225.01 Y 14 21008952 C545* T A nonsense Het probably null phenotype 09/13/2019
74 570350 UTSW Vmn1r120 0.088 R7348 G1 225.01 Y 7 21053452 S111R A T missense Het probably damaging 0.995 09/13/2019
75 570361 UTSW Wwox 0.889 R7348 G1 225.01 Y 8 114472652 C146S T A missense Het probably benign 0.004 phenotype 09/13/2019
76 570367 UTSW Zbtb2 0.872 R7348 G1 225.01 Y 10 4374574 T57A T C missense Het possibly damaging 0.482 09/13/2019
77 570339 UTSW Zfp362 0.243 R7348 G1 225.01 Y 4 128777217 D336G T C missense Het possibly damaging 0.885 0.355 09/13/2019
78 570348 UTSW Zfp628 0.428 R7348 G1 225.01 Y 7 4921818 G1013E G A missense Het probably damaging 0.990 phenotype 09/13/2019
79 570330 UTSW Zfp704 0.000 R7348 G1 225.01 Y 3 9474598 S231P A G missense Het probably damaging 0.999 phenotype 09/13/2019
80 570329 UTSW Zhx3 1.000 R7348 G1 225.01 Y 2 160782118 S43* G T nonsense Het probably null phenotype 09/13/2019
[records 1 to 80 of 80]