Incidental Mutations

91 incidental mutations are currently displayed, and affect 90 genes.
15 are Possibly Damaging.
31 are Probably Damaging.
24 are Probably Benign.
14 are Probably Null.
8 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 91 of 91] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 571119 UTSW 4932415D10Rik 0.089 R7358 G1 225.01 N 10 82292013 L1721S A G missense Het possibly damaging 0.787 09/13/2019
2 571145 UTSW Abca17 0.000 R7358 G1 225.01 N 17 24291555 Q983L T A missense Het probably benign 0.002 09/13/2019
3 571132 UTSW Agtr1a 0.000 R7358 G1 225.01 N 13 30380979 D9V A T missense Het probably benign 0.053 phenotype 09/13/2019
4 571086 UTSW Ankrd13c 0.792 R7358 G1 225.01 N 3 157991737 Y326* T A nonsense Het probably null 09/13/2019
5 571096 UTSW Ano2 0.090 R7358 G1 225.01 N 6 125710733 D67G A G missense Het probably benign 0.000 phenotype 09/13/2019
6 571095 UTSW Arhgef5 0.000 R7358 G1 225.01 N 6 43279573 R1205H G A missense Het probably damaging 1.000 phenotype 09/13/2019
7 571117 UTSW Ascc3 0.960 R7358 G1 225.01 N 10 50714352 Y1055* T A nonsense Het probably null phenotype 09/13/2019
8 571127 UTSW Atad5 1.000 R7358 G1 225.01 N 11 80133036 A1658V C T missense Het probably benign 0.316 phenotype 09/13/2019
9 571134 UTSW Atp6ap1l 0.071 R7358 G1 225.01 N 13 90883807 D252G T C missense Het probably damaging 1.000 09/13/2019
10 571135 UTSW BC067074 0.339 R7358 G1 225.01 N 13 113319967 D849G A G missense Het 09/13/2019
11 571131 UTSW Bdkrb2 0.080 R7358 G1 225.01 N 12 105592541 V347A T C missense Het possibly damaging 0.673 phenotype 09/13/2019
12 571070 UTSW Ccdc187 0.104 R7358 G1 225.01 N 2 26255995 L1194Q A T missense Het probably damaging 0.974 09/13/2019
13 571109 UTSW Chd9 0.000 R7358 G1 225.01 N 8 90983487 D770A A C missense Het unknown 09/13/2019
14 571110 UTSW Chd9 0.000 R7358 G1 225.01 N 8 91034218 D2197G A G missense Het unknown 09/13/2019
15 571090 UTSW Clip2 0.390 R7358 G1 225.01 N 5 134502630 E774* C A nonsense Het probably null phenotype 09/13/2019
16 571087 UTSW Clspn 1.000 R7358 G1 225.01 N 4 126566200 T407A A G missense Het probably benign 0.022 phenotype 09/13/2019
17 571085 UTSW Col24a1 0.000 R7358 G1 225.01 N 3 145293165 T A critical splice donor site 2 bp Het probably null phenotype 09/13/2019
18 571120 UTSW Cradd 1.000 R7358 G1 225.01 N 10 95322775 T37S T A missense Het probably damaging 0.987 phenotype 09/13/2019
19 571108 UTSW Ctbp2 1.000 R7358 G1 225.01 N 7 132998881 F70S A G missense Het probably damaging 1.000 phenotype 09/13/2019
20 571083 UTSW D3Ertd751e 0.098 R7358 G1 225.01 N 3 41746565 E6D A T missense Het probably damaging 0.993 09/13/2019
21 571064 UTSW Dst 0.255 R7358 G1 225.01 N 1 34191673 F2782L T A missense Het probably benign 0.000 phenotype 09/13/2019
22 571113 UTSW Dync2h1 1.000 R7358 G1 225.01 N 9 7159479 A G critical splice donor site 2 bp Het probably null phenotype 09/13/2019
23 571129 UTSW Eif2s1 1.000 R7358 G1 225.01 N 12 78881195 G215V G T missense Het probably damaging 0.996 phenotype 09/13/2019
24 571148 UTSW Epg5 0.917 R7358 G1 225.01 N 18 77959037 D557V A T missense Het possibly damaging 0.780 phenotype 09/13/2019
25 571116 UTSW Eya4 1.000 R7358 G1 225.01 N 10 23123851 C T critical splice donor site 1 bp Het probably null phenotype 09/13/2019
26 571111 UTSW Fam192a 0.284 R7358 G1 225.01 N 8 94575699 N235D T C missense Het possibly damaging 0.881 09/13/2019
27 571143 UTSW Fpr1 0.000 R7358 G1 225.01 N 17 17876980 R249L C A missense Het probably damaging 0.994 phenotype 09/13/2019
28 571093 UTSW Fry 0.719 R7358 G1 225.01 N 5 150416323 T1520A A G missense Het probably benign 0.000 09/13/2019
29 571072 UTSW Gapvd1 1.000 R7358 G1 225.01 N 2 34690461 C T critical splice donor site 1 bp Het probably null 09/13/2019
30 571126 UTSW Gemin4 0.961 R7358 G1 225.01 N 11 76213452 L161* A C nonsense Het probably null phenotype 09/13/2019
31 571082 UTSW Gid8 0.928 R7358 G1 225.01 N 2 180717986 K221I A T missense Het probably benign 0.027 09/13/2019
32 571099 UTSW Gm21028 0.124 R7358 G1 225.01 N 7 42578489 C34G A C missense Het probably damaging 0.999 09/13/2019
33 571142 UTSW Gm4737 0.927 R7358 G1 225.01 N 16 46153838 E392G T C missense Het probably damaging 1.000 09/13/2019
34 571128 UTSW Greb1 0.000 R7358 G1 225.01 N 12 16724881 S172P A G missense Het probably damaging 1.000 phenotype 09/13/2019
35 571101 UTSW Herc2 0.932 R7358 G1 225.01 N 7 56182675 I3040V A G missense Het possibly damaging 0.480 phenotype 09/13/2019
36 571071 UTSW Hmcn2 0.000 R7358 G1 225.01 N 2 31416812 V3190E T A missense Het probably damaging 0.995 09/13/2019
37 571084 UTSW Hrnr 0.000 R7358 G1 225.01 N 3 93323141 G229* G T nonsense Het probably null 09/13/2019
38 571068 UTSW Igfn1 0.097 R7358 G1 225.01 N 1 135964000 V2259D A T missense Het probably damaging 1.000 09/13/2019
39 571130 UTSW Ism2 0.000 R7358 G1 225.01 N 12 87280040 F375S A G missense Het probably damaging 0.999 09/13/2019
40 571150 UTSW Kcnk4 0.000 R7358 G1 225.01 N 19 6926110 D357V T A missense Het probably damaging 1.000 phenotype 09/13/2019
41 571077 UTSW Knl1 1.000 R7358 G1 225.01 N 2 119070559 R914G A G missense Het possibly damaging 0.916 phenotype 09/13/2019
42 571065 UTSW Mars2 1.000 R7358 G1 225.01 N 1 55237570 S111P T C missense Het probably damaging 1.000 phenotype 09/13/2019
43 571103 UTSW Mogat2 0.163 R7358 G1 225.01 N 7 99232466 P88S G A missense Het possibly damaging 0.925 phenotype 09/13/2019
44 571146 UTSW Msh2 0.857 R7358 G1 225.01 N 17 87717529 S612T T A missense Het possibly damaging 0.890 phenotype 09/13/2019
45 571069 UTSW Nvl 0.960 R7358 G1 225.01 N 1 181135036 L123P A G missense Het probably damaging 0.983 0.266 phenotype 09/13/2019
46 571076 UTSW Olfr1029 0.054 R7358 G1 225.01 N 2 85975436 S64R T A missense Het possibly damaging 0.812 phenotype 09/13/2019
47 571073 UTSW Olfr352 0.066 R7358 G1 225.01 N 2 36869878 V104A T C missense Het probably benign 0.000 phenotype 09/13/2019
48 571105 UTSW Olfr621-ps1 0.090 R7358 G1 225.01 N 7 103629183 L259P A G missense Het unknown 09/13/2019
49 571106 UTSW Olfr709-ps1 0.131 R7358 G1 225.01 N 7 106926904 L185Q A T missense Het probably damaging 1.000 09/13/2019
50 571121 UTSW Olfr771 0.056 R7358 G1 225.01 N 10 129160070 I305F T A missense Het probably benign 0.000 phenotype 09/13/2019
51 571115 UTSW Olfr868 0.158 R7358 G1 225.01 N 9 20100873 Y38F A T missense Het probably damaging 1.000 phenotype 09/13/2019
52 571089 UTSW P2rx7 0.000 R7358 G1 225.01 N 5 122666142 A T critical splice acceptor site Het probably null phenotype 09/13/2019
53 571112 UTSW Pard3 1.000 R7358 G1 225.01 N 8 127593092 I1149L A T missense Het probably damaging 0.981 phenotype 09/13/2019
54 571147 UTSW Pcdha8 0.103 R7358 G1 225.01 N 18 36992777 I104N T A missense Het probably damaging 1.000 phenotype 09/13/2019
55 571067 UTSW Pecr 0.162 R7358 G1 225.01 N 1 72267465 T219I G A missense Het probably benign 0.006 09/13/2019
56 571104 UTSW Pgap2 1.000 R7358 G1 225.01 N 7 102210567 A T unclassified Het probably benign 09/13/2019
57 571139 UTSW Phf7 0.000 R7358 G1 225.01 N 14 31241788 R76G T C missense Het probably benign 0.006 phenotype 09/13/2019
58 571081 UTSW Pigu 1.000 R7358 G1 225.01 N 2 155299170 T268A T C missense Het probably damaging 0.998 phenotype 09/13/2019
59 571114 UTSW Piwil4 0.275 R7358 G1 225.01 N 9 14729993 T231A T C missense Het possibly damaging 0.819 phenotype 09/13/2019
60 571122 UTSW Pkd1l1 1.000 R7358 G1 225.01 N 11 8945202 E636A T G missense Het phenotype 09/13/2019
61 571125 UTSW Plscr3 0.000 R7358 G1 225.01 N 11 69847490 S55P T C missense Het unknown phenotype 09/13/2019
62 571151 UTSW Pnlip 0.127 R7358 G1 225.01 N 19 58676544 I268N T A missense Het probably damaging 1.000 phenotype 09/13/2019
63 571094 UTSW Podxl 1.000 R7358 G1 225.01 N 6 31524994 H343Q A T missense Het probably benign 0.031 phenotype 09/13/2019
64 571137 UTSW Prkcd 0.492 R7358 G1 225.01 N 14 30605836 T213A T C missense Het probably benign 0.000 phenotype 09/13/2019
65 571144 UTSW Prss22 0.074 R7358 G1 225.01 N 17 23996445 Q119L T A missense Het probably benign 0.057 phenotype 09/13/2019
66 571149 UTSW Ptprcap 0.077 R7358 G1 225.01 N 19 4156239 E107G A G missense Het possibly damaging 0.847 phenotype 09/13/2019
67 571136 UTSW Ptprg 0.000 R7358 G1 225.01 N 14 12154198 T640A A G missense Het possibly damaging 0.587 phenotype 09/13/2019
68 571097 UTSW Ptprh 0.000 R7358 G1 225.01 N 7 4551007 A T splice site 6 bp Het probably null 0.976 phenotype 09/13/2019
69 571091 UTSW Rasa4 0.117 R7358 G1 225.01 N 5 136095594 T166A A G missense Het probably benign 0.029 phenotype 09/13/2019
70 571107 UTSW Sbf2 0.461 R7358 G1 225.01 N 7 110399348 E626G T C missense Het possibly damaging 0.952 phenotype 09/13/2019
71 571074 UTSW Scn2a 1.000 R7358 G1 225.01 N 2 65682506 Y203* T A nonsense Het probably null phenotype 09/13/2019
72 571133 UTSW Serpinb1a 0.109 R7358 G1 225.01 N 13 32842998 H320Q G C missense Het probably damaging 1.000 phenotype 09/13/2019
73 571098 UTSW Shisa7 0.000 R7358 G1 225.01 N 7 4829921 T464I G A missense Het probably benign 0.246 phenotype 09/13/2019
74 571124 UTSW Slc47a2 0.000 R7358 G1 225.01 N 11 61308873 A399V G A missense Het possibly damaging 0.784 09/13/2019
75 571138 UTSW Smim4 1.000 R7358 G1 225.01 N 14 31124603 V53A A G missense Het probably damaging 1.000 phenotype 09/13/2019
76 571079 UTSW Snrnp200 1.000 R7358 G1 225.01 N 2 127221826 T642A A G missense Het probably benign 0.026 phenotype 09/13/2019
77 571066 UTSW Spag16 0.140 R7358 G1 225.01 N 1 69844367 H85R A G missense Het probably benign 0.003 phenotype 09/13/2019
78 571153 UTSW Sry 0.318 R7358 G1 208.46 N Y 2662638 GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG small deletion Het probably benign phenotype 09/13/2019
79 571092 UTSW Stag3 0.000 R7358 G1 225.01 N 5 138301508 L894M C A missense Het probably damaging 1.000 phenotype 09/13/2019
80 571141 UTSW Sun2 0.000 R7358 G1 225.01 N 15 79734112 F284Y A T missense Het probably benign 0.293 phenotype 09/13/2019
81 571080 UTSW Tpx2 1.000 R7358 G1 225.01 N 2 152876630 N184K T A missense Het probably benign 0.000 phenotype 09/13/2019
82 571063 UTSW Trpa1 0.158 R7358 G1 225.01 N 1 14898110 N477K A T missense Het probably damaging 1.000 phenotype 09/13/2019
83 571078 UTSW Ttbk2 1.000 R7358 G1 225.01 N 2 120790310 R157H C T missense Het probably damaging 0.996 phenotype 09/13/2019
84 571075 UTSW Ttn 1.000 R7358 G1 225.01 N 2 76707305 E34760K C T missense Het probably benign 0.363 phenotype 09/13/2019
85 571118 UTSW Tysnd1 0.074 R7358 G1 225.01 N 10 61696648 S360P T C missense Het probably damaging 1.000 phenotype 09/13/2019
86 571123 UTSW Usp34 0.647 R7358 G1 225.01 N 11 23361683 L511I T A missense Het probably damaging 0.987 09/13/2019
87 571102 UTSW Vmn2r71 0.076 R7358 G1 225.01 N 7 85624260 T761S A T missense Het possibly damaging 0.814 09/13/2019
88 571088 UTSW Zdhhc18 0.139 R7358 G1 198.01 N 4 133633171 C73* G T nonsense Het probably null 09/13/2019
89 571100 UTSW Zfp975 0.090 R7358 G1 225.01 N 7 42662791 C133S A T missense Het probably damaging 0.998 09/13/2019
90 571152 UTSW Zfy1 0.047 R7358 G1 222 N Y 735141 E214G T C missense Het unknown 09/13/2019
91 571140 UTSW Zmym5 0.397 R7358 G1 180.01 N 14 56794140 K504* T A nonsense Het probably null 09/13/2019
[records 1 to 91 of 91]