Incidental Mutations

49 incidental mutations are currently displayed, and affect 49 genes.
9 are Possibly Damaging.
10 are Probably Damaging.
19 are Probably Benign.
10 are Probably Null.
2 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 49 of 49] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 573323 UTSW Anxa11 0.230 R7389 G1 225.01 Y 14 25872888 P182Q C A missense Het probably damaging 0.987 phenotype 09/13/2019
2 573303 UTSW Asns 0.512 R7389 G1 225.01 Y 6 7689291 L70F C A missense Het probably damaging 0.997 0.268 phenotype 09/13/2019
3 573307 UTSW Cd163l1 0.000 R7389 G1 225.01 Y 7 140228791 K872E A G missense Het possibly damaging 0.948 09/13/2019
4 573294 UTSW Cntrl 0.875 R7389 G1 225.01 Y 2 35127517 K445N A T missense Het probably benign 0.009 0.060 phenotype 09/13/2019
5 573334 UTSW Cyp2c50 0.076 R7389 G1 225.01 Y 19 40090663 R150L G T missense Het probably benign 0.007 09/13/2019
6 573304 UTSW Dqx1 0.074 R7389 G1 225.01 Y 6 83064794 S539I G T missense Het probably null 0.993 09/13/2019
7 573335 UTSW Dusp9 0.197 R7389 G1 142.47 Y X 73640611 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG small deletion Het probably benign phenotype 09/13/2019
8 573327 UTSW Epha3 0.441 R7389 G1 225.01 Y 16 63772984 E247G T C missense Het probably damaging 1.000 phenotype 09/13/2019
9 573293 UTSW Etl4 0.683 R7389 G1 225.01 Y 2 20785093 Q801* C T nonsense Het probably null 0.971 phenotype 09/13/2019
10 573298 UTSW Fabp2 0.146 R7389 G1 225.01 Y 3 122895365 G T start gained Het probably benign phenotype 09/13/2019
11 573295 UTSW Fsip2 0.110 R7389 G1 225.01 Y 2 82988796 V4958I G A missense Het possibly damaging 0.511 0.107 phenotype 09/13/2019
12 573311 UTSW Fstl3 0.000 R7389 G1 225.01 Y 10 79780031 C117Y G A missense Het probably damaging 1.000 phenotype 09/13/2019
13 573329 UTSW Hdgfl2 0.189 R7389 G1 225.01 Y 17 56099389 T G critical splice donor site 2 bp Het probably null phenotype 09/13/2019
14 573292 UTSW Igfn1 0.097 R7389 G1 225.01 Y 1 135967047 D1927G T C missense Het probably benign 0.002 09/13/2019
15 573297 UTSW Ino80 0.954 R7389 G1 225.01 Y 2 119442529 S489A A C missense Het probably benign 0.002 phenotype 09/13/2019
16 573317 UTSW Krt15 0.090 R7389 G1 225.01 Y 11 100135560 V100E A T missense Het possibly damaging 0.792 0.179 phenotype 09/13/2019
17 573299 UTSW Lrriq3 0.095 R7389 G1 225.01 Y 3 155188104 T481A A G missense Het probably benign 0.003 0.072 09/13/2019
18 573315 UTSW Map2k3 0.000 R7389 G1 221.01 Y 11 60932036 A T unclassified Het probably benign 0.090 phenotype 09/13/2019
19 573331 UTSW Matr3 0.958 R7389 G1 225.01 Y 18 35584585 T617A A G missense Het probably benign 0.000 phenotype 09/13/2019
20 573306 UTSW Mybpc2 1.000 R7389 G1 225.01 Y 7 44505604 T960P T G missense Het probably benign 0.107 0.090 phenotype 09/13/2019
21 573289 UTSW Ncoa2 0.960 R7389 G1 225.01 Y 1 13186825 N150S T C missense Het possibly damaging 0.624 phenotype 09/13/2019
22 573322 UTSW Nup153 0.948 R7389 G1 225.01 Y 13 46700987 A T critical splice donor site 2 bp Het probably null phenotype 09/13/2019
23 573314 UTSW Obscn 0.811 R7389 G1 225.01 Y 11 59036400 L5498P A G missense Het probably benign 0.023 0.380 phenotype 09/13/2019
24 573328 UTSW Olfr111 0.563 R7389 G1 225.01 Y 17 37530657 R227G A G missense Het possibly damaging 0.716 0.215 phenotype 09/13/2019
25 573333 UTSW Olfr1444 0.209 R7389 G1 225.01 Y 19 12862617 V281L G T missense Het probably benign 0.037 phenotype 09/13/2019
26 573290 UTSW Paqr8 0.000 R7389 G1 225.01 Y 1 20935165 P181Q C A missense Het probably damaging 1.000 09/13/2019
27 573332 UTSW Pcdhgb4 0.136 R7389 G1 225.01 Y 18 37722363 Y604H T C missense Het probably damaging 1.000 phenotype 09/13/2019
28 573330 UTSW Pja2 0.000 R7389 G1 225.01 Y 17 64297727 E487V T A missense Het probably damaging 1.000 09/13/2019
29 573309 UTSW Pnpla6 1.000 R7389 G1 225.01 Y 8 3543981 R1331* C T nonsense Het probably null phenotype 09/13/2019
30 596096 UTSW Ppl 0.000 R7389 G1 225.01 Y 16 5106713 T A intron 49 bp Het probably null phenotype 11/18/2019
31 573316 UTSW Rhbdl3 0.072 R7389 G1 225.01 Y 11 80346839 M299K T A missense Het possibly damaging 0.949 0.897 09/13/2019
32 573291 UTSW Slc26a9 0.888 R7389 G1 225.01 N 1 131769248 *791W A G makesense Het probably null phenotype 09/13/2019
33 573310 UTSW Slc7a2 0.000 R7389 G1 225.01 Y 8 40912515 Y461C A G missense Het probably benign 0.000 phenotype 09/13/2019
34 573319 UTSW Sptb 0.876 R7389 G1 225.01 Y 12 76624229 Q447K G T missense Het probably damaging 0.981 phenotype 09/13/2019
35 573302 UTSW Ssh1 0.000 R7389 G1 225.01 Y 5 113958831 I205N A T missense Het probably benign 0.283 0.095 phenotype 09/13/2019
36 573324 UTSW Stab1 0.000 R7389 G1 225.01 Y 14 31147239 V1511I C T missense Het probably benign 0.002 phenotype 09/13/2019
37 573318 UTSW Tex19.1 0.228 R7389 G1 225.01 Y 11 121147160 W115R T C missense Het possibly damaging 0.918 0.179 phenotype 09/13/2019
38 596095 UTSW Tinf2 1.000 R7389 G1 225.01 Y 14 55680710 G T splice site Het probably null phenotype 11/18/2019
39 596094 UTSW Tmeff1 0.429 R7389 G1 215.01 Y 4 48617097 A G intron Het probably null 11/18/2019
40 573301 UTSW Tnip2 0.225 R7389 G1 225.01 Y 5 34513801 Q33K G T missense Het probably benign 0.037 phenotype 09/13/2019
41 573320 UTSW Traf3 1.000 R7389 G1 225.01 Y 12 111237753 L59M C A missense Het probably damaging 1.000 0.622 phenotype 09/13/2019
42 573325 UTSW Trav14d-3-dv8 0.511 R7389 G1 225.01 Y 14 53078871 Y63H T C missense Het possibly damaging 0.905 09/13/2019
43 573313 UTSW Trim11 0.278 R7389 G1 225.01 Y 11 58990655 S458L C T missense Het probably damaging 0.996 0.394 phenotype 09/13/2019
44 573296 UTSW Tspan18 0.000 R7389 G1 225.01 Y 2 93209927 V161E A T missense Het probably benign 0.055 0.184 09/13/2019
45 573326 UTSW Usf3 0.291 R7389 G1 225.01 Y 16 44217941 V928E T A missense Het probably benign 0.093 09/13/2019
46 573305 UTSW Usp29 0.000 R7389 G1 225.01 Y 7 6963458 V767I G A missense Het possibly damaging 0.819 0.179 09/13/2019
47 573312 UTSW Usp34 0.647 R7389 G1 225.01 Y 11 23345200 F287L T G missense Het 0.158 09/13/2019
48 573321 UTSW Vmn1r213 0.099 R7389 G1 225.01 Y 13 23012386 C380R T C missense Het probably benign 0.178 09/13/2019
49 573300 UTSW Zfyve9 0.505 R7389 G1 225.01 Y 4 108693318 A G critical splice donor site 2 bp Het probably null phenotype 09/13/2019
[records 1 to 49 of 49]