Incidental Mutations

70 incidental mutations are currently displayed, and affect 70 genes.
12 are Possibly Damaging.
24 are Probably Damaging.
20 are Probably Benign.
9 are Probably Null.
5 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 573677 UTSW 1700017N19Rik 0.073 R7394 G1 225.01 Y 10 100609176 I208V A G missense Het probably benign 0.010 0.085 09/13/2019
2 573636 UTSW Abcb11 0.625 R7394 G1 225.01 Y 2 69299867 D282N C T missense Het probably damaging 0.990 phenotype 09/13/2019
3 573676 UTSW Aldh1l2 0.000 R7394 G1 225.01 Y 10 83502457 I646F T A missense Het probably damaging 0.995 0.687 phenotype 09/13/2019
4 573653 UTSW Alms1 0.000 R7394 G1 225.01 Y 6 85622223 P1344S C T missense Het possibly damaging 0.543 0.179 phenotype 09/13/2019
5 573641 UTSW Ank2 1.000 R7394 G1 225.01 Y 3 126936653 I711L T A missense Het possibly damaging 0.774 0.171 phenotype 09/13/2019
6 573643 UTSW Ankrd6 0.000 R7394 G1 225.01 Y 4 32821298 N251D T C missense Het probably damaging 0.985 0.114 phenotype 09/13/2019
7 573686 UTSW Ap3m1 0.098 R7394 G1 225.01 Y 14 21038079 T304A T C missense Het probably benign 0.004 phenotype 09/13/2019
8 573644 UTSW Arhgef39 0.106 R7394 G1 225.01 Y 4 43499532 T26A T C missense Het possibly damaging 0.900 09/13/2019
9 573650 UTSW C530008M17Rik 0.000 R7394 G1 152.47 N 5 76856954 GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG small deletion Het probably benign 09/13/2019
10 573699 UTSW Carnmt1 0.960 R7394 G1 225.01 Y 19 18670837 G T start gained Het probably benign phenotype 09/13/2019
11 573672 UTSW Ccr4 0.000 R7394 G1 225.01 Y 9 114491926 R357H C T missense Het probably benign 0.000 phenotype 09/13/2019
12 573657 UTSW Cd4 0.000 R7394 G1 225.01 Y 6 124873041 M104L T A missense Het probably benign 0.003 0.090 phenotype 09/13/2019
13 573696 UTSW Cd74 0.206 R7394 G1 225.01 Y 18 60803893 A T start gained Het probably benign 0.090 phenotype 09/13/2019
14 573674 UTSW Cdcp1 0.000 R7394 G1 225.01 Y 9 123173813 Y731C T C missense Het probably damaging 1.000 phenotype 09/13/2019
15 573669 UTSW Cdyl2 0.151 R7394 G1 225.01 N 8 116624051 S114P A G missense Het not run 09/13/2019
16 573680 UTSW Cenpv 0.188 R7394 G1 225.01 Y 11 62536288 D148G T C missense Het probably damaging 0.959 0.729 09/13/2019
17 615897 UTSW Cep89 0.177 R7394 G1 225.01 Y 7 35429928 R630H G A missense Het probably damaging 0.969 0.647 01/13/2020
18 573647 UTSW Cfap57 0.000 R7394 G1 225.01 Y 4 118593137 Y596F T A missense Het probably benign 0.005 0.076 phenotype 09/13/2019
19 573656 UTSW Clec4a2 0.049 R7394 G1 225.01 Y 6 123139120 A122E C A missense Het unknown 0.087 phenotype 09/13/2019
20 573663 UTSW Col4a2 1.000 R7394 G1 225.01 Y 8 11446184 T1602A A G missense Het probably benign 0.001 phenotype 09/13/2019
21 573646 UTSW Cyp2j11 0.060 R7394 G1 225.01 Y 4 96316440 Y290N A T missense Het probably benign 0.003 0.090 09/13/2019
22 573668 UTSW Dhx38 0.964 R7394 G1 225.01 Y 8 109556523 V554E A T missense Het probably damaging 0.999 phenotype 09/13/2019
23 573688 UTSW Ebf2 0.956 R7394 G1 225.01 Y 14 67237526 V70A T C missense Het probably damaging 0.993 phenotype 09/13/2019
24 573692 UTSW Enpp5 0.000 R7394 G1 225.01 Y 17 44085264 G356S G A missense Het probably damaging 1.000 0.917 phenotype 09/13/2019
25 573682 UTSW Fam217a 0.134 R7394 G1 225.01 Y 13 34910279 I499K A T missense Het possibly damaging 0.734 09/13/2019
26 573651 UTSW Fras1 0.000 R7394 G1 225.01 Y 5 96712450 Y2118* C A nonsense Het probably null phenotype 09/13/2019
27 573685 UTSW Gm3248 0.074 R7394 G1 82.01 N 14 5945781 A T critical splice donor site 2 bp Het probably null 09/13/2019
28 573687 UTSW Gm5460 0.056 R7394 G1 225.01 Y 14 34043922 D165E T G missense Het possibly damaging 0.805 09/13/2019
29 573648 UTSW Grk4 0.137 R7394 G1 225.01 Y 5 34751618 N490Y A T missense Het probably benign 0.000 0.085 phenotype 09/13/2019
30 615899 UTSW Iglc2 0.076 R7394 G1 225.01 Y 16 19195136 K59* T A nonsense Het probably null 01/13/2020
31 573655 UTSW Iqsec3 0.000 R7394 G1 225.01 Y 6 121386610 H895L T A missense Het possibly damaging 0.473 0.349 09/13/2019
32 573691 UTSW Itgb7 0.209 R7394 G1 225.01 Y 15 102219254 S410P A G missense Het probably damaging 1.000 phenotype 09/13/2019
33 573690 UTSW Kmt2d 1.000 R7394 G1 225.01 Y 15 98856384 V1613F C A missense Het unknown phenotype 09/13/2019
34 573694 UTSW Lama1 1.000 R7394 G1 225.01 Y 17 67717261 L118P T C missense Het phenotype 09/13/2019
35 573665 UTSW Lrrc25 0.070 R7394 G1 225.01 Y 8 70618180 S204C A T missense Het possibly damaging 0.598 0.171 09/13/2019
36 573635 UTSW Malrd1 0.092 R7394 G1 225.01 Y 2 15695199 D619G A G missense Het unknown 09/13/2019
37 573698 UTSW Ms4a6d 0.059 R7394 G1 225.01 Y 19 11590073 Q155* G A nonsense Het probably null 0.976 phenotype 09/13/2019
38 573645 UTSW Mup17 R7394 G1 197.01 N 4 61594398 S86F G A missense Het probably benign 0.016 09/13/2019
39 573671 UTSW Nbeal2 0.285 R7394 G1 225.01 Y 9 110630189 C T critical splice donor site 1 bp Het probably null phenotype 09/13/2019
40 573642 UTSW Nfkb1 0.000 R7394 G1 225.01 Y 3 135613697 V291G A C missense Het possibly damaging 0.541 0.125 phenotype 09/13/2019
41 573660 UTSW Nomo1 0.697 R7394 G1 225.01 Y 7 46066479 V757F G T missense Het probably benign 0.259 09/13/2019
42 573683 UTSW Nutm2 0.000 R7394 G1 225.01 Y 13 50470007 S247T T A missense Het probably damaging 0.999 09/13/2019
43 573637 UTSW Olfr1225 0.053 R7394 G1 225.01 Y 2 89170361 V284I C T missense Het probably benign 0.000 phenotype 09/13/2019
44 573638 UTSW Olfr1291-ps1 0.136 R7394 G1 225.01 Y 2 111499896 A215S G T missense Het probably damaging 0.977 09/13/2019
45 573661 UTSW Olfr521 0.088 R7394 G1 225.01 Y 7 99767346 H61Q C A missense Het probably damaging 1.000 0.633 phenotype 09/13/2019
46 573678 UTSW Olfr826 0.086 R7394 G1 225.01 Y 10 130180254 I209F T A missense Het probably damaging 1.000 0.647 phenotype 09/13/2019
47 573670 UTSW Olfr834 0.754 R7394 G1 225.01 Y 9 18988710 C241S T A missense Het probably damaging 0.993 phenotype 09/13/2019
48 573695 UTSW Pcdhb14 0.158 R7394 G1 225.01 Y 18 37448908 I356V A G missense Het probably benign 0.292 09/13/2019
49 573659 UTSW Pnkp 0.959 R7394 G1 225.01 Y 7 44858678 S142T T A missense Het probably damaging 0.993 phenotype 09/13/2019
50 573679 UTSW Ppia 0.618 R7394 G1 225.01 Y 11 6419218 S99P T C missense Het possibly damaging 0.770 phenotype 09/13/2019
51 573684 UTSW Prss47 0.061 R7394 G1 225.01 Y 13 65044993 V325I C T missense Het probably benign 0.110 0.090 09/13/2019
52 573693 UTSW Ptk7 1.000 R7394 G1 225.01 Y 17 46591757 D34G T C missense Het probably damaging 1.000 phenotype 09/13/2019
53 573675 UTSW Pwp2 0.746 R7394 G1 225.01 Y 10 78182480 G126R C T missense Het probably damaging 1.000 0.238 09/13/2019
54 573664 UTSW Rasa3 1.000 R7394 G1 225.01 Y 8 13595353 D195E G T missense Het probably benign 0.029 phenotype 09/13/2019
55 573666 UTSW Rnf150 0.444 R7394 G1 225.01 Y 8 82990471 Y202* T A nonsense Het probably null 0.971 09/13/2019
56 573633 UTSW Sh2d1b2 0.000 R7394 G1 225.01 Y 1 170248147 V50A T C missense Het probably damaging 0.970 phenotype 09/13/2019
57 573639 UTSW Slc30a4 0.000 R7394 G1 225.01 Y 2 122685304 V390I C T missense Het possibly damaging 0.928 phenotype 09/13/2019
58 573649 UTSW Slc30a9 0.926 R7394 G1 225.01 Y 5 67352766 G T critical splice donor site 1 bp Het probably null 09/13/2019
59 615898 UTSW Slc8a3 0.000 R7394 G1 225.01 Y 12 81214058 T A splice site 8 bp Het probably null phenotype 01/13/2020
60 573667 UTSW Smpd3 0.915 R7394 G1 225.01 Y 8 106265010 R304W G A missense Het probably damaging 0.991 phenotype 09/13/2019
61 573640 UTSW Snta1 0.586 R7394 G1 225.01 Y 2 154376860 S490P A G missense Het probably damaging 0.999 phenotype 09/13/2019
62 573662 UTSW Srcap 0.964 R7394 G1 225.01 Y 7 127534828 M887R T G missense Het probably damaging 0.999 0.857 phenotype 09/13/2019
63 573689 UTSW St3gal1 0.156 R7394 G1 225.01 Y 15 67111346 V187A A G missense Het possibly damaging 0.524 0.453 phenotype 09/13/2019
64 573658 UTSW Sult2a3 0.000 R7394 G1 225.01 Y 7 14111524 T137A T C missense Het probably benign 0.048 0.090 phenotype 09/13/2019
65 573681 UTSW Tspoap1 0.000 R7394 G1 225.01 Y 11 87766119 Q367* C T nonsense Het probably null Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators] (source: MGI)">phenotype 09/13/2019
66 573654 UTSW Uroc1 0.000 R7394 G1 225.01 Y 6 90345333 R280C C T missense Het probably damaging 1.000 0.514 phenotype 09/13/2019
67 573634 UTSW Ush2a 0.479 R7394 G1 225.01 Y 1 188911416 I4325T T C missense Het possibly damaging 0.827 phenotype 09/13/2019
68 573652 UTSW Vmn1r32 0.051 R7394 G1 225.01 Y 6 66553189 I201T A G missense Het probably benign 0.058 09/13/2019
69 573697 UTSW Zadh2 0.174 R7394 G1 225.01 Y 18 84088190 A9V C T missense Het probably benign 0.002 09/13/2019
70 573673 UTSW Zfp651 0.126 R7394 G1 225.01 Y 9 121767345 M626K T A missense Het probably damaging 0.984 09/13/2019
[records 1 to 70 of 70]