Incidental Mutations

74 incidental mutations are currently displayed, and affect 74 genes.
15 are Possibly Damaging.
24 are Probably Damaging.
27 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 74 of 74] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 574543 UTSW 1700010I14Rik 0.000 R7405 G1 225.01 N 17 9001817 V383L G T missense Het probably damaging 0.990 09/13/2019
2 574492 UTSW 1700012P22Rik 0.055 R7405 G1 225.01 N 4 144419753 N110S T C missense Het probably damaging 0.983 09/13/2019
3 574537 UTSW 2410141K09Rik 0.071 R7405 G1 225.01 N 13 66431059 Q455R T C missense Het unknown 09/13/2019
4 574519 UTSW 4930507D05Rik 0.231 R7405 G1 225.01 N 10 62449784 H96N C A missense Het unknown 09/13/2019
5 574544 UTSW 4930539E08Rik 0.000 R7405 G1 225.01 N 17 28905324 R335W G A missense Het probably damaging 1.000 09/13/2019
6 574495 UTSW 5730480H06Rik 0.299 R7405 G1 225.01 N 5 48388116 I235T T C missense Het possibly damaging 0.948 09/13/2019
7 574484 UTSW Abcb11 0.570 R7405 G1 225.01 N 2 69287619 Y472H A G missense Het probably damaging 1.000 phenotype 09/13/2019
8 574512 UTSW Adam39 0.066 R7405 G1 225.01 N 8 40824622 I17L A T missense Het probably benign 0.010 09/13/2019
9 574520 UTSW Aire 0.000 R7405 G1 225.01 N 10 78034613 H458R T C missense Het probably benign 0.015 phenotype 09/13/2019
10 574522 UTSW Ap3d1 0.932 R7405 G1 199.01 N 10 80741900 D31G T C missense Het probably benign 0.164 phenotype 09/13/2019
11 574533 UTSW Atad2b 0.000 R7405 G1 225.01 N 12 4943232 H250Q T A missense Het probably benign 0.076 phenotype 09/13/2019
12 574502 UTSW Borcs5 0.896 R7405 G1 225.01 N 6 134685982 T74N C A missense Het probably benign 0.090 09/13/2019
13 574509 UTSW Btbd16 0.000 R7405 G1 225.01 N 7 130805856 T292I C T missense Het probably benign 0.082 phenotype 09/13/2019
14 574548 UTSW Catsperd 0.055 R7405 G1 225.01 N 17 56632335 V55M G A missense Het possibly damaging 0.951 0.179 phenotype 09/13/2019
15 574507 UTSW Ctr9 1.000 R7405 G1 225.01 N 7 111043714 F462S T C missense Het possibly damaging 0.901 phenotype 09/13/2019
16 574545 UTSW Cyp4f39 0.351 R7405 G1 225.01 N 17 32481815 S153G A G missense Het probably benign 0.015 phenotype 09/13/2019
17 574518 UTSW Ddo 0.000 R7405 G1 225.01 N 10 40647997 C328R T C missense Het possibly damaging 0.477 phenotype 09/13/2019
18 574546 UTSW Ddr1 0.881 R7405 G1 225.01 N 17 35690100 V251A A G missense Het probably damaging 0.999 phenotype 09/13/2019
19 574514 UTSW Dis3l 0.330 R7405 G1 225.01 N 9 64314704 F475L A G missense Het probably damaging 0.996 phenotype 09/13/2019
20 574510 UTSW Dkk4 0.000 R7405 G1 225.01 N 8 22625843 V99M G A missense Het probably benign 0.055 phenotype 09/13/2019
21 574536 UTSW Dync1h1 1.000 R7405 G1 225.01 N 12 110634220 A1938V C T missense Het probably damaging 1.000 phenotype 09/13/2019
22 574479 UTSW Ecel1 1.000 R7405 G1 225.01 N 1 87153516 A T critical splice donor site 2 bp Het probably null phenotype 09/13/2019
23 574525 UTSW Fbxo7 0.000 R7405 G1 225.01 N 10 86044581 Y377N T A missense Het probably damaging 0.998 phenotype 09/13/2019
24 574517 UTSW Fbxw24 0.055 R7405 G1 225.01 N 9 109607068 I299V T C missense Het possibly damaging 0.459 09/13/2019
25 574531 UTSW Fkbp10 1.000 R7405 G1 225.01 N 11 100415881 A33V C T missense Het probably damaging 0.998 phenotype 09/13/2019
26 574528 UTSW Gabra1 0.240 R7405 G1 225.01 N 11 42155023 T87A T C missense Het probably damaging 0.999 phenotype 09/13/2019
27 574549 UTSW Gm21886 0.063 R7405 G1 168.46 N 18 80089825 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG small deletion Het probably benign 0.090 09/13/2019
28 574532 UTSW Gm884 0.180 R7405 G1 225.01 N 11 103615161 Y1994N A T missense Het probably benign 0.024 09/13/2019
29 574497 UTSW Golga3 0.000 R7405 G1 225.01 N 5 110208446 I1000F A T missense Het probably damaging 0.970 phenotype 09/13/2019
30 574498 UTSW Grid2ip 0.214 R7405 G1 225.01 N 5 143380444 I563T T C missense Het probably benign 0.033 phenotype 09/13/2019
31 574499 UTSW Gsx1 0.503 R7405 G1 225.01 N 5 147189133 S82P T C missense Het possibly damaging 0.930 phenotype 09/13/2019
32 574541 UTSW Heg1 0.198 R7405 G1 225.01 N 16 33763449 K34E A G missense Het possibly damaging 0.659 phenotype 09/13/2019
33 574551 UTSW Kank1 0.000 R7405 G1 225.01 N 19 25410319 L452* T A nonsense Het probably null phenotype 09/13/2019
34 574489 UTSW Lce1k 0.155 R7405 G1 225.01 N 3 92806874 M1K A T start codon destroyed Het probably null 09/13/2019
35 574487 UTSW Lcmt2 0.062 R7405 G1 225.01 N 2 121139387 I185T A G missense Het probably benign 0.066 phenotype 09/13/2019
36 574527 UTSW Lrp1 1.000 R7405 G1 225.01 N 10 127581751 D1046G T C missense Het possibly damaging 0.928 phenotype 09/13/2019
37 574513 UTSW Mast3 0.000 R7405 G1 225.01 N 8 70786171 D496E A T missense Het probably damaging 1.000 09/13/2019
38 574516 UTSW Mst1r 0.277 R7405 G1 225.01 N 9 107915122 S925F C T missense Het possibly damaging 0.872 phenotype 09/13/2019
39 574524 UTSW Mterf2 0.211 R7405 G1 225.01 N 10 85120496 G88D C T missense Het probably damaging 1.000 phenotype 09/13/2019
40 574534 UTSW Mthfd1 1.000 R7405 G1 225.01 N 12 76311874 V783A T C missense Het probably damaging 0.980 phenotype 09/13/2019
41 574504 UTSW Mybpc2 1.000 R7405 G1 225.01 N 7 44507194 W778R A T missense Het probably damaging 1.000 phenotype 09/13/2019
42 574488 UTSW Nbea 1.000 R7405 G1 225.01 N 3 55805266 L2130P A G missense Het possibly damaging 0.943 phenotype 09/13/2019
43 574491 UTSW Ndst4 0.127 R7405 G1 225.01 N 3 125683216 N30S A G missense Het probably benign 0.000 phenotype 09/13/2019
44 574503 UTSW Nphs1 1.000 R7405 G1 225.01 N 7 30462828 V299A T C missense Het possibly damaging 0.464 phenotype 09/13/2019
45 574526 UTSW Nup107 0.969 R7405 G1 225.01 N 10 117770415 D474G T C missense Het probably benign 0.019 phenotype 09/13/2019
46 574486 UTSW Olfr1118 0.082 R7405 G1 225.01 N 2 87308995 I89L A C missense Het probably benign 0.004 phenotype 09/13/2019
47 574550 UTSW Olfr1490 0.159 R7405 G1 225.01 N 19 13654882 V151A T C missense Het probably benign 0.135 phenotype 09/13/2019
48 574529 UTSW Olfr225 0.054 R7405 G1 225.01 N 11 59614073 F370I T A missense Het possibly damaging 0.533 09/13/2019
49 574521 UTSW Olfr8 0.224 R7405 G1 225.01 N 10 78955697 V164A T C missense Het probably benign 0.135 phenotype 09/13/2019
50 574505 UTSW Pgap2 1.000 R7405 G1 225.01 N 7 102231388 V41A T C missense Het probably benign 0.013 09/13/2019
51 574535 UTSW Plekhh1 0.000 R7405 G1 225.01 N 12 79055047 T297I C T missense Het probably benign 0.001 09/13/2019
52 574500 UTSW Plxna4 0.620 R7405 G1 225.01 N 6 32196319 Y1226N A T missense Het probably benign 0.001 phenotype 09/13/2019
53 574523 UTSW Polr3b 1.000 R7405 G1 225.01 N 10 84684179 D653G A G missense Het probably benign 0.000 phenotype 09/13/2019
54 574493 UTSW Ppp2r2c 0.259 R7405 G1 225.01 N 5 36947142 F289L T C missense Het possibly damaging 0.710 phenotype 09/13/2019
55 574501 UTSW Prickle2 0.517 R7405 G1 225.01 N 6 92458543 S82P A G missense Het probably damaging 0.957 phenotype 09/13/2019
56 574538 UTSW Ptger2 0.000 R7405 G1 225.01 N 14 44989074 V37D T A missense Het probably damaging 0.999 phenotype 09/13/2019
57 574515 UTSW Rasa2 0.108 R7405 G1 225.01 N 9 96566027 P526S G A missense Het probably benign 0.091 phenotype 09/13/2019
58 574496 UTSW Rbm47 0.228 R7405 G1 225.01 N 5 66026495 I255N A T missense Het probably damaging 0.980 phenotype 09/13/2019
59 574530 UTSW Sez6 0.000 R7405 G1 225.01 N 11 77962891 T296S A T missense Het probably benign 0.097 phenotype 09/13/2019
60 574494 UTSW Slc2a9 0.060 R7405 G1 225.01 N 5 38391824 I316F T A missense Het probably damaging 0.998 phenotype 09/13/2019
61 574480 UTSW Slc41a1 0.000 R7405 G1 225.01 N 1 131839146 V134D T A missense Het probably damaging 0.999 09/13/2019
62 574547 UTSW Slc5a7 1.000 R7405 G1 225.01 N 17 54297133 S2T A T missense Het probably benign 0.000 phenotype 09/13/2019
63 574478 UTSW Slc9a4 0.000 R7405 G1 225.01 N 1 40600926 R293C C T missense Het probably damaging 1.000 phenotype 09/13/2019
64 574542 UTSW Son 0.961 R7405 G1 192.46 N 16 91656691 CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC unclassified Het probably benign phenotype 09/13/2019
65 574483 UTSW Suco 0.677 R7405 G1 225.01 N 1 161828214 F1039L A G missense Het possibly damaging 0.648 phenotype 09/13/2019
66 574490 UTSW Sycp1 0.380 R7405 G1 225.01 N 3 102925227 Y208H A G missense Het possibly damaging 0.722 phenotype 09/13/2019
67 574482 UTSW Tpr 1.000 R7405 G1 225.01 N 1 150442127 S2129P T C missense Het probably benign 0.019 phenotype 09/13/2019
68 574506 UTSW Trim34b 0.376 R7405 G1 225.01 N 7 104336483 S442T T A missense Het probably damaging 1.000 09/13/2019
69 574485 UTSW Ttn 1.000 R7405 G1 225.01 N 2 76743346 Y25734* A T nonsense Het probably null phenotype 09/13/2019
70 574481 UTSW Uchl5 1.000 R7405 G1 225.01 N 1 143800014 Q276* C T nonsense Het probably null phenotype 09/13/2019
71 574511 UTSW Wrn 0.548 R7405 G1 225.01 N 8 33248966 W1278S C G missense Het probably benign 0.001 phenotype 09/13/2019
72 574540 UTSW Yeats2 0.958 R7405 G1 225.01 N 16 20222913 D1184E T A missense Het probably damaging 1.000 phenotype 09/13/2019
73 574539 UTSW Zfat 1.000 R7405 G1 225.01 N 15 68184485 R241W G A missense Het probably damaging 1.000 phenotype 09/13/2019
74 574508 UTSW Zfp646 0.261 R7405 G1 225.01 N 7 127878796 Y48* T A nonsense Het probably null 09/13/2019
[records 1 to 74 of 74]