Incidental Mutations

71 incidental mutations are currently displayed, and affect 71 genes.
10 are Possibly Damaging.
23 are Probably Damaging.
23 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
8 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 575117 UTSW 1810055G02Rik 0.086 R7411 G1 225.01 N 19 3717241 T276I C T missense Het possibly damaging 0.915 10/07/2019
2 575118 UTSW 9130011E15Rik 1.000 R7411 G1 225.01 N 19 45965435 V170G A C missense Het probably benign 0.004 10/07/2019
3 575110 UTSW Abca17 0.000 R7411 G1 225.01 N 17 24328569 I277T A G missense Het possibly damaging 0.525 10/07/2019
4 575053 UTSW Abcb11 0.183 R7411 G1 225.01 N 2 69303936 C T critical splice donor site 1 bp Het probably null phenotype 10/07/2019
5 575084 UTSW Abcc12 0.066 R7411 G1 225.01 N 8 86560850 R122L C A missense Het possibly damaging 0.947 phenotype 10/07/2019
6 575079 UTSW Abcc8 0.446 R7411 G1 225.01 N 7 46165917 A G critical splice donor site 2 bp Het probably null phenotype 10/07/2019
7 575107 UTSW Adam28 0.132 R7411 G1 225.01 N 14 68626947 R469K C T missense Het probably damaging 1.000 phenotype 10/07/2019
8 575086 UTSW Adamts18 0.117 R7411 G1 225.01 N 8 113777730 Y243C T C missense Het probably damaging 0.987 phenotype 10/07/2019
9 575070 UTSW Agbl3 0.000 R7411 G1 225.01 N 6 34814819 S619P T C missense Het probably damaging 0.991 phenotype 10/07/2019
10 575080 UTSW Alpk3 0.464 R7411 G1 225.01 N 7 81092852 T806S A T missense Het probably benign 0.109 phenotype 10/07/2019
11 575071 UTSW Atoh1 1.000 R7411 G1 225.01 N 6 64729930 I203N T A missense Het probably damaging 0.999 phenotype 10/07/2019
12 575113 UTSW Cables1 0.706 R7411 G1 225.01 N 18 11840515 E237G A G missense Het probably benign 0.008 phenotype 10/07/2019
13 575104 UTSW Cacna1d 0.784 R7411 G1 225.01 N 14 30352990 M1T A G start codon destroyed Het probably null phenotype 10/07/2019
14 575075 UTSW Ccdc91 0.119 R7411 G1 225.01 N 6 147592198 Q363* C T nonsense Het probably null 10/07/2019
15 575076 UTSW Ceacam5 0.063 R7411 G1 225.01 N 7 17750753 D473E T A missense Het probably damaging 0.994 10/07/2019
16 575091 UTSW Cfap54 0.089 R7411 G1 225.01 N 10 92868755 D2821V T A missense Het unknown phenotype 10/07/2019
17 575058 UTSW Clca3a2 0.147 R7411 G1 225.01 N 3 144802099 S737P A G missense Het probably damaging 0.997 10/07/2019
18 575074 UTSW Clec4n 0.000 R7411 G1 225.01 N 6 123232186 M70K T A missense Het probably benign 0.061 0.090 phenotype 10/07/2019
19 575051 UTSW Dstyk 0.155 R7411 G1 181.01 N 1 132417666 G21S G A missense Het probably benign 0.012 phenotype 10/07/2019
20 575111 UTSW Enpp5 0.000 R7411 G1 225.01 N 17 44081475 D265G A G missense Het probably damaging 1.000 phenotype 10/07/2019
21 575066 UTSW Gabrb1 0.000 R7411 G1 225.01 N 5 72122195 T C critical splice donor site 2 bp Het probably null phenotype 10/07/2019
22 575099 UTSW Gm11639 0.114 R7411 G1 225.01 N 11 104999723 N4210K T G missense Het probably benign 0.096 10/07/2019
23 575065 UTSW Gm28710 0.237 R7411 G1 225.01 N 5 16824765 T500S A T missense Het possibly damaging 0.955 10/07/2019
24 575082 UTSW Gm40460 R7411 G1 116.46 N 7 142240817 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 10/07/2019
25 575063 UTSW Gm5861 0.201 R7411 G1 85.01 N 5 11183149 T A critical splice donor site 2 bp Het probably null 10/07/2019
26 575088 UTSW Gm9513 0.087 R7411 G1 225.01 N 9 36475684 V16A T C missense Het possibly damaging 0.904 10/07/2019
27 575094 UTSW Guk1 0.959 R7411 G1 225.01 N 11 59185985 F91L A G missense Het phenotype 10/07/2019
28 575069 UTSW Ints1 1.000 R7411 G1 225.01 N 5 139764260 E961K C T missense Het possibly damaging 0.539 phenotype 10/07/2019
29 575102 UTSW Irx2 0.773 R7411 G1 125.01 N 13 72629063 M1K T A start codon destroyed Het probably null 0.990 phenotype 10/07/2019
30 575108 UTSW Jrk 0.088 R7411 G1 225.01 N 15 74707199 R79H C T missense Het possibly damaging 0.465 phenotype 10/07/2019
31 575083 UTSW Kcnu1 0.000 R7411 G1 225.01 N 8 25892088 V489L G T missense Het probably damaging 0.998 phenotype 10/07/2019
32 575067 UTSW Kctd7 0.000 R7411 G1 225.01 N 5 130152424 T209M C T missense Het probably benign 0.369 phenotype 10/07/2019
33 575073 UTSW Kdm5a 1.000 R7411 G1 225.01 N 6 120426815 V1127E T A missense Het probably damaging 0.999 phenotype 10/07/2019
34 575077 UTSW Klk6 0.000 R7411 G1 225.01 N 7 43826943 H69R A G missense Het probably damaging 1.000 phenotype 10/07/2019
35 575061 UTSW Lck 0.000 R7411 G1 225.01 N 4 129551970 K340R T C missense Het probably benign 0.024 phenotype 10/07/2019
36 575095 UTSW Lrrc75a 0.088 R7411 G1 225.01 N 11 62605908 L276P A G missense Het probably damaging 0.998 10/07/2019
37 575078 UTSW Med25 1.000 R7411 G1 225.01 N 7 44878243 W730R A G missense Het probably damaging 0.979 phenotype 10/07/2019
38 575109 UTSW Muc4 0.109 R7411 G1 225.01 N 16 32751322 V400A T C missense Het probably benign 0.117 phenotype 10/07/2019
39 575068 UTSW Myl10 0.000 R7411 G1 225.01 N 5 136697971 V70L G C missense Het probably benign 0.001 0.067 10/07/2019
40 575056 UTSW Myt1 1.000 R7411 G1 225.01 N 2 181815106 H906Q C A missense Het probably damaging 1.000 phenotype 10/07/2019
41 575050 UTSW Ncl 0.963 R7411 G1 225.01 N 1 86350842 F673I A T missense Het probably damaging 0.996 phenotype 10/07/2019
42 575098 UTSW Nfe2l1 1.000 R7411 G1 225.01 N 11 96822183 T216N G T missense Het probably benign 0.372 phenotype 10/07/2019
43 575097 UTSW Nos2 0.000 R7411 G1 225.01 N 11 78944855 G A critical splice donor site 1 bp Het probably null phenotype 10/07/2019
44 575062 UTSW Nphp4 0.195 R7411 G1 203.01 N 4 152554717 I935N T A missense Het probably benign 0.251 phenotype 10/07/2019
45 575096 UTSW Ntn1 0.392 R7411 G1 216.01 N 11 68386089 A11V G A missense Het probably benign 0.150 phenotype 10/07/2019
46 575054 UTSW Olfr1257 0.069 R7411 G1 225.01 N 2 89881261 V145A T C missense Het probably damaging 0.980 phenotype 10/07/2019
47 575093 UTSW Olfr1395 0.064 R7411 G1 225.01 N 11 49148994 M246L A T missense Het probably benign 0.008 phenotype 10/07/2019
48 575115 UTSW Pcdha12 0.233 R7411 G1 225.01 N 18 37021608 Y460C A G missense Het probably damaging 1.000 phenotype 10/07/2019
49 575114 UTSW Pcdha4 0.159 R7411 G1 225.01 N 18 36953058 R98L G T missense Het probably benign 0.008 phenotype 10/07/2019
50 575100 UTSW Pitpnc1 0.177 R7411 G1 225.01 N 11 107212572 S234P A G missense Het probably damaging 0.988 10/07/2019
51 575085 UTSW Pmfbp1 0.116 R7411 G1 225.01 N 8 109513871 Y195F A T missense Het probably damaging 1.000 10/07/2019
52 575101 UTSW Prl6a1 0.082 R7411 G1 225.01 N 13 27318142 I164T T C missense Het probably damaging 1.000 10/07/2019
53 575048 UTSW Ptpn18 0.180 R7411 G1 225.01 N 1 34472192 G A critical splice donor site 1 bp Het probably null phenotype 10/07/2019
54 575060 UTSW Rhbdl2 0.000 R7411 G1 225.01 N 4 123829642 A280T G A missense Het possibly damaging 0.690 0.094 phenotype 10/07/2019
55 575081 UTSW Rsf1 1.000 R7411 G1 217.47 N 7 97579932 CGGC CGGCGGCGGGGGC unclassified Het probably benign phenotype 10/07/2019
56 575064 UTSW Sema3a 0.950 R7411 G1 225.01 N 5 13516263 Y171* T G nonsense Het probably null phenotype 10/07/2019
57 575052 UTSW Set 0.749 R7411 G1 174.01 N 2 30066885 E22G A G missense Het probably benign 0.002 phenotype 10/07/2019
58 575057 UTSW Sirpb1b 0.062 R7411 G1 225.01 N 3 15542997 D229E A T missense Het probably benign 0.218 10/07/2019
59 575116 UTSW Slc12a2 0.000 R7411 G1 225.01 N 18 57941013 I1096F A T missense Het probably benign 0.011 phenotype 10/07/2019
60 575103 UTSW Slc30a5 0.373 R7411 G1 225.01 N 13 100818180 I159V T C missense Het probably benign 0.147 phenotype 10/07/2019
61 575087 UTSW Slc35f3 0.146 R7411 G1 217.47 N 8 126389038 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC critical splice acceptor site Het unknown 10/07/2019
62 575090 UTSW Slc6a20b 0.000 R7411 G1 225.01 N 9 123604948 I275T A G missense Het probably benign 0.321 10/07/2019
63 575049 UTSW Stradb 0.000 R7411 G1 225.01 N 1 58988518 D69A A C missense Het possibly damaging 0.947 phenotype 10/07/2019
64 575106 UTSW Supt16 0.968 R7411 G1 225.01 N 14 52178051 V409E A T missense Het probably damaging 0.995 phenotype 10/07/2019
65 575055 UTSW Tcea2 0.287 R7411 G1 225.01 N 2 181686664 N195S A G missense Het probably damaging 1.000 phenotype 10/07/2019
66 575072 UTSW Thumpd3 0.175 R7411 G1 225.01 N 6 113056111 V270A T C missense Het possibly damaging 0.915 10/07/2019
67 575092 UTSW Urgcp 0.178 R7411 G1 225.01 N 11 5718116 H117L T A missense Het probably benign 0.098 phenotype 10/07/2019
68 575089 UTSW Vps13c 0.000 R7411 G1 225.01 N 9 67972001 M3408K T A missense Het probably damaging 0.980 phenotype 10/07/2019
69 575105 UTSW Wdfy4 0.000 R7411 G1 225.01 N 14 33106131 M1078R A C missense Het 10/07/2019
70 575059 UTSW Wdr63 0.113 R7411 G1 225.01 N 3 146097145 V97A A G missense Het probably damaging 0.975 10/07/2019
71 575112 UTSW Ypel5 0.936 R7411 G1 225.01 N 17 72846444 G A critical splice donor site 1 bp Het probably null 10/07/2019
[records 1 to 71 of 71]