Incidental Mutations

57 incidental mutations are currently displayed, and affect 57 genes.
15 are Possibly Damaging.
15 are Probably Damaging.
19 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 57 of 57] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 576937 UTSW 1700007K13Rik 0.070 R7441 G1 178.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 10/07/2019
2 576943 UTSW 4921509C19Rik 0.000 R7441 G1 225.01 N 2 151472925 S278A A C missense Het possibly damaging 0.513 10/07/2019
3 576981 UTSW Adamts20 0.170 R7441 G1 225.01 N 15 94353673 D411G T C missense Het probably damaging 0.999 phenotype 10/07/2019
4 576948 UTSW Adgrl3 0.000 R7441 G1 225.01 N 5 81724140 I894V A G missense Het possibly damaging 0.704 phenotype 10/07/2019
5 576952 UTSW Adprhl1 0.000 R7441 G1 225.01 N 8 13223069 V1230I C T missense Het probably benign 0.008 phenotype 10/07/2019
6 576984 UTSW Agpat1 0.839 R7441 G1 225.01 N 17 34610909 Y77N T A missense Het probably damaging 0.996 phenotype 10/07/2019
7 576951 UTSW Anpep 0.000 R7441 G1 225.01 N 7 79827644 V725A A G missense Het possibly damaging 0.926 phenotype 10/07/2019
8 576986 UTSW Apc 0.969 R7441 G1 225.01 N 18 34312073 I674K T A missense Het probably damaging 1.000 phenotype 10/07/2019
9 576944 UTSW Arhgef2 0.647 R7441 G1 225.01 N 3 88643955 R808G A G missense Het probably damaging 0.959 phenotype 10/07/2019
10 576979 UTSW Asap1 0.198 R7441 G1 225.01 N 15 64130256 V402A A G missense Het probably damaging 0.998 phenotype 10/07/2019
11 576972 UTSW Aspg 0.208 R7441 G1 196.01 N 12 112124821 V479A T C missense Het possibly damaging 0.904 10/07/2019
12 576973 UTSW B3galnt2 1.000 R7441 G1 225.01 N 13 13994485 V368M G A missense Het probably benign 0.337 phenotype 10/07/2019
13 576969 UTSW Bahcc1 0.817 R7441 G1 213.01 N 11 120286306 S2007P T C missense Het probably damaging 0.993 phenotype 10/07/2019
14 576963 UTSW Cyfip2 1.000 R7441 G1 225.01 N 11 46196427 I1212N A T missense Het possibly damaging 0.801 phenotype 10/07/2019
15 576946 UTSW Dnajc16 0.606 R7441 G1 225.01 N 4 141763813 D675E A T missense Het probably damaging 0.999 10/07/2019
16 576945 UTSW Dram2 0.000 R7441 G1 225.01 N 3 106555187 F4L T C missense Het probably damaging 1.000 10/07/2019
17 576974 UTSW Dsp 1.000 R7441 G1 225.01 N 13 38195449 T2057A A G missense Het probably benign 0.001 phenotype 10/07/2019
18 576971 UTSW Dync1h1 1.000 R7441 G1 225.01 N 12 110636453 L2176R T G missense Het probably damaging 1.000 phenotype 10/07/2019
19 576985 UTSW Efhb 0.086 R7441 G1 225.01 N 17 53401521 I707N A T missense Het possibly damaging 0.777 10/07/2019
20 576941 UTSW Eif2ak4 0.000 R7441 G1 225.01 N 2 118471896 T1555A A G missense Het probably benign 0.007 phenotype 10/07/2019
21 576949 UTSW Erc1 1.000 R7441 G1 225.01 N 6 119824951 T35I G A missense Het possibly damaging 0.861 phenotype 10/07/2019
22 576970 UTSW Esr2 0.643 R7441 G1 225.01 N 12 76141394 M363I C A missense Het probably benign 0.015 phenotype 10/07/2019
23 576936 UTSW Etl4 0.683 R7441 G1 225.01 N 2 20744189 N446I A T missense Het possibly damaging 0.870 phenotype 10/07/2019
24 576968 UTSW Evpl 0.000 R7441 G1 225.01 N 11 116222956 K1303* T A nonsense Het probably null phenotype 10/07/2019
25 576953 UTSW Fam129c 0.000 R7441 G1 225.01 N 8 71600164 D94G A G missense Het probably benign 0.345 0.559 10/07/2019
26 576980 UTSW Fam135b 0.000 R7441 G1 225.01 N 15 71463680 V555E A T missense Het probably damaging 0.983 10/07/2019
27 576982 UTSW Fam186b 0.000 R7441 G1 225.01 N 15 99280089 L452P A G missense Het probably benign 0.005 phenotype 10/07/2019
28 576940 UTSW Fmn1 0.318 R7441 G1 225.01 N 2 113441611 Q108L A T missense Het unknown phenotype 10/07/2019
29 576961 UTSW Gcc2 0.187 R7441 G1 225.01 N 10 58256901 T48A A G missense Het probably benign 0.076 phenotype 10/07/2019
30 576964 UTSW Gm12169 0.093 R7441 G1 225.01 N 11 46528555 W66* G A nonsense Het probably null 10/07/2019
31 576950 UTSW Gm6619 0.100 R7441 G1 225.01 N 6 131490391 I73S T G missense Het possibly damaging 0.663 10/07/2019
32 576976 UTSW Gm8267 0.105 R7441 G1 108.01 N 14 44722940 D116V T A missense Het probably damaging 1.000 10/07/2019
33 576931 UTSW Gtf3c3 0.960 R7441 G1 225.01 N 1 54420448 T385M G A missense Het probably benign 0.001 phenotype 10/07/2019
34 576975 UTSW Iqgap2 0.000 R7441 G1 225.01 N 13 95628076 M1553I C A missense Het probably benign 0.235 phenotype 10/07/2019
35 576955 UTSW Kcnk1 0.000 R7441 G1 225.01 N 8 125995568 G37C G T missense Het probably damaging 1.000 phenotype 10/07/2019
36 576954 UTSW Kifc3 0.000 R7441 G1 225.01 N 8 95137987 M32V T C missense Het probably benign 0.003 phenotype 10/07/2019
37 576983 UTSW Krt81 0.074 R7441 G1 225.01 N 15 101461370 K222N C A missense Het possibly damaging 0.947 phenotype 10/07/2019
38 576978 UTSW Lrrc63 0.066 R7441 G1 225.01 N 14 75126257 S145P A G missense Het possibly damaging 0.838 10/07/2019
39 576965 UTSW Mybbp1a 1.000 R7441 G1 225.01 N 11 72451275 V1279E T A missense Het probably benign 0.009 phenotype 10/07/2019
40 576938 UTSW Olfr1044 0.145 R7441 G1 225.01 N 2 86171010 D269V T A missense Het probably damaging 0.998 phenotype 10/07/2019
41 576977 UTSW Olfr742 0.062 R7441 G1 225.01 N 14 50515396 Y64F A T missense Het probably damaging 1.000 phenotype 10/07/2019
42 576947 UTSW Pramef8 0.063 R7441 G1 225.01 N 4 143418840 Y293C A G missense Het probably benign 0.002 10/07/2019
43 576930 UTSW Ptpn18 0.179 R7441 G1 225.01 N 1 34473335 V407A T C missense Het probably benign 0.004 phenotype 10/07/2019
44 576958 UTSW Ptpn9 0.532 R7441 G1 225.01 N 9 57027433 Y160* T A nonsense Het probably null phenotype 10/07/2019
45 576939 UTSW Ptprj 0.204 R7441 G1 225.01 N 2 90449819 K1045R T C missense Het possibly damaging 0.823 phenotype 10/07/2019
46 576967 UTSW Rundc3a 0.199 R7441 G1 225.01 N 11 102400046 G T critical splice donor site 1 bp Het probably null 10/07/2019
47 576959 UTSW Scn11a 0.118 R7441 G1 225.01 N 9 119758626 V1351I C T missense Het probably benign 0.006 phenotype 10/07/2019
48 576933 UTSW Slc26a9 0.888 R7441 G1 225.01 N 1 131762818 Y520C A G missense Het probably damaging 1.000 phenotype 10/07/2019
49 576966 UTSW Spata20 0.278 R7441 G1 225.01 N 11 94484041 A245V G A missense Het probably benign 0.017 10/07/2019
50 576932 UTSW Steap3 0.000 R7441 G1 225.01 N 1 120241518 F350V A C missense Het probably benign 0.312 phenotype 10/07/2019
51 576934 UTSW Swt1 0.216 R7441 G1 225.01 N 1 151411064 F226I A T missense Het probably benign 0.037 10/07/2019
52 576960 UTSW Taar7f 0.118 R7441 G1 225.01 N 10 24049987 T160A A G missense Het possibly damaging 0.879 10/07/2019
53 576935 UTSW Upf2 1.000 R7441 G1 225.01 N 2 6018932 I698F A T missense Het unknown phenotype 10/07/2019
54 576962 UTSW Vmn2r84 0.071 R7441 G1 225.01 N 10 130392113 T85A T C missense Het possibly damaging 0.897 10/07/2019
55 576956 UTSW Zfp426 0.090 R7441 G1 225.01 N 9 20470851 E280G T C missense Het possibly damaging 0.948 phenotype 10/07/2019
56 576957 UTSW Zfp810 0.128 R7441 G1 225.01 N 9 22279272 E78* C A nonsense Het probably null 10/07/2019
57 576942 UTSW Zfp937 0.079 R7441 G1 184.47 N 2 150238710 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G frame shift Het probably null 10/07/2019
[records 1 to 57 of 57]