Incidental Mutations

74 incidental mutations are currently displayed, and affect 74 genes.
9 are Possibly Damaging.
34 are Probably Damaging.
24 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 74 of 74] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 577565 UTSW Abca16 0.000 R7449 G1 225.01 N 7 120435908 Y306N T A missense Het possibly damaging 0.948 10/07/2019
2 577590 UTSW Adgrv1 0.000 R7449 G1 225.01 N 13 81499073 V3116D A T missense Het probably damaging 0.988 phenotype 10/07/2019
3 577585 UTSW Adssl1 0.191 R7449 G1 225.01 N 12 112634151 T185S A T missense Het probably damaging 0.999 phenotype 10/07/2019
4 577596 UTSW Ago2 1.000 R7449 G1 225.01 N 15 73146499 P30L G A missense Het probably damaging 0.999 phenotype 10/07/2019
5 577599 UTSW Atp5j 0.336 R7449 G1 225.01 N 16 84831363 V44M C T missense Het probably benign 0.090 phenotype 10/07/2019
6 577567 UTSW Atp7b 0.768 R7449 G1 225.01 N 8 22011849 I833F T A missense Het probably damaging 0.977 phenotype 10/07/2019
7 577608 UTSW Birc6 1.000 R7449 G1 225.01 N 17 74702341 N4869K T A missense Het probably benign 0.000 phenotype 10/07/2019
8 577555 UTSW Cacna1c 0.296 R7449 G1 225.01 N 6 118602349 D1796N C T missense Het phenotype 10/07/2019
9 577547 UTSW Ccng2 0.000 R7449 G1 225.01 N 5 93273343 S237R C G missense Het probably benign 0.003 0.090 phenotype 10/07/2019
10 577546 UTSW Cnga1 0.240 R7449 G1 225.01 N 5 72605304 I289T A G missense Het probably benign 0.287 phenotype 10/07/2019
11 577572 UTSW Crybg1 1.000 R7449 G1 225.01 N 10 44004519 E224D C A missense Het probably benign 0.000 10/07/2019
12 577552 UTSW Dysf 0.000 R7449 G1 225.01 N 6 84137380 L1217P T C missense Het possibly damaging 0.898 phenotype 10/07/2019
13 577594 UTSW Ebf2 0.959 R7449 G1 225.01 N 14 67410020 N339K T A missense Het probably damaging 0.991 phenotype 10/07/2019
14 577600 UTSW Eva1c 0.061 R7449 G1 225.01 N 16 90876193 T C critical splice donor site 2 bp Het probably null 0.947 phenotype 10/07/2019
15 577589 UTSW Fam172a 0.186 R7449 G1 225.01 N 13 77759442 I41V A G missense Het probably damaging 0.998 10/07/2019
16 577573 UTSW Fam184a 0.164 R7449 G1 225.01 N 10 53698634 E293G T C missense Het probably damaging 0.977 10/07/2019
17 577561 UTSW Folh1 0.000 R7449 G1 225.01 N 7 86731748 P506S G A missense Het probably benign 0.001 phenotype 10/07/2019
18 577574 UTSW Ftcd 0.182 R7449 G1 225.01 N 10 76580163 K210N A T missense Het probably benign 0.022 phenotype 10/07/2019
19 577544 UTSW Gdf6 0.180 R7449 G1 225.01 N 4 9844494 V6D T A missense Het possibly damaging 0.724 phenotype 10/07/2019
20 577592 UTSW Ghitm 0.254 R7449 G1 225.01 N 14 37131581 G101C C A missense Het probably damaging 1.000 10/07/2019
21 577551 UTSW Gimap5 0.000 R7449 G1 225.01 N 6 48752904 V136D T A missense Het probably damaging 0.997 phenotype 10/07/2019
22 577586 UTSW Gm9745 0.173 R7449 G1 225.01 N 13 8943304 H51L T A missense Het probably damaging 1.000 10/07/2019
23 577603 UTSW Grm4 0.000 R7449 G1 225.01 N 17 27435371 G535D C T missense Het probably damaging 1.000 phenotype 10/07/2019
24 577569 UTSW Gse1 0.157 R7449 G1 225.01 N 8 120229711 S314P T C missense Het unknown 10/07/2019
25 577548 UTSW Hnrnpdl 0.232 R7449 G1 225.01 N 5 100037155 I279T A G missense Het probably damaging 0.988 phenotype 10/07/2019
26 577554 UTSW Itpr1 0.785 R7449 G1 225.01 N 6 108389384 S923P T C missense Het probably damaging 0.981 phenotype 10/07/2019
27 577579 UTSW Krt39 0.068 R7449 G1 225.01 N 11 99518061 C303F C A missense Het probably benign 0.016 phenotype 10/07/2019
28 577553 UTSW Lrrn1 0.343 R7449 G1 225.01 N 6 107568521 S427P T C missense Het possibly damaging 0.906 phenotype 10/07/2019
29 577581 UTSW Lrrn3 0.169 R7449 G1 225.01 N 12 41453488 R277W T A missense Het probably damaging 1.000 phenotype 10/07/2019
30 577593 UTSW Ltb4r1 0.080 R7449 G1 225.01 N 14 55767918 L226P T C missense Het probably damaging 0.996 phenotype 10/07/2019
31 577591 UTSW Map1b 1.000 R7449 G1 225.01 N 13 99508140 R85Q C T missense Het probably damaging 0.994 phenotype 10/07/2019
32 577566 UTSW Mcoln1 0.153 R7449 G1 225.01 N 8 3507285 L125P T C missense Het probably damaging 0.977 phenotype 10/07/2019
33 577587 UTSW Nid1 0.264 R7449 G1 225.01 N 13 13482051 V589G T G missense Het probably damaging 1.000 phenotype 10/07/2019
34 577557 UTSW Nlrp5 0.164 R7449 G1 225.01 N 7 23417526 F225C T G missense Het probably benign 0.003 phenotype 10/07/2019
35 577604 UTSW Notch3 0.000 R7449 G1 225.01 N 17 32157966 A322T C T missense Het probably damaging 1.000 phenotype 10/07/2019
36 577560 UTSW Olfr299 0.094 R7449 G1 225.01 N 7 86465855 H148R A G missense Het probably benign 0.319 phenotype 10/07/2019
37 577563 UTSW Olfr69 0.073 R7449 G1 225.01 N 7 103767819 Q193K G T missense Het probably benign 0.000 phenotype 10/07/2019
38 577570 UTSW Olfr854 0.279 R7449 G1 225.01 N 9 19566866 T173S T A missense Het probably benign 0.063 phenotype 10/07/2019
39 577576 UTSW Otogl 0.000 R7449 G1 225.01 N 10 107803663 C1363R A G missense Het probably damaging 1.000 phenotype 10/07/2019
40 577609 UTSW Ovol1 0.680 R7449 G1 225.01 N 19 5553597 D92V T A missense Het probably benign 0.014 phenotype 10/07/2019
41 577541 UTSW Pigt 0.824 R7449 G1 225.01 N 2 164502499 L356P T C missense Het probably damaging 0.997 phenotype 10/07/2019
42 577582 UTSW Plekhg3 0.000 R7449 G1 225.01 N 12 76566222 Q434R A G missense Het probably damaging 0.984 10/07/2019
43 577583 UTSW Plekhh1 0.000 R7449 G1 225.01 N 12 79079552 F1344L T C missense Het probably benign 0.001 10/07/2019
44 577578 UTSW Psmd3 0.950 R7449 G1 225.01 N 11 98695551 L515Q T A missense Het probably damaging 1.000 0.647 phenotype 10/07/2019
45 577549 UTSW Pus1 0.412 R7449 G1 225.01 N 5 110774586 L405P A G missense Het probably damaging 1.000 phenotype 10/07/2019
46 577598 UTSW Qtrt2 0.078 R7449 G1 225.01 N 16 43881032 H55L T A missense Het probably benign 0.057 phenotype 10/07/2019
47 577540 UTSW Rasgrp1 0.255 R7449 G1 225.01 N 2 117287943 I522V T C missense Het probably damaging 0.997 0.096 phenotype 10/07/2019
48 577545 UTSW Raver2 0.111 R7449 G1 225.01 N 4 101102663 H113Q T A missense Het probably damaging 0.995 10/07/2019
49 577597 UTSW Recql4 1.000 R7449 G1 225.01 N 15 76705565 D760G T C missense Het unknown phenotype 10/07/2019
50 577588 UTSW Rhobtb3 0.145 R7449 G1 225.01 N 13 75910741 V313M C T missense Het probably benign 0.139 phenotype 10/07/2019
51 577611 UTSW Rhox4d 0.065 R7449 G1 222 N X 37518992 G191E G A missense Het unknown 10/07/2019
52 577595 UTSW Rictor 1.000 R7449 G1 225.01 N 15 6772154 S441L C T missense Het probably benign 0.272 0.102 phenotype 10/07/2019
53 577577 UTSW Rnf185 0.154 R7449 G1 225.01 N 11 3426578 Q135R T C missense Het probably benign 0.271 10/07/2019
54 577571 UTSW Sema3f 0.000 R7449 G1 225.01 N 9 107684036 S584G T C missense Het probably damaging 0.999 phenotype 10/07/2019
55 577610 UTSW Sh3pxd2a 1.000 R7449 G1 225.01 N 19 47267652 T904S T A missense Het probably benign 0.000 phenotype 10/07/2019
56 577539 UTSW Slc4a10 0.000 R7449 G1 225.01 N 2 62303946 V1002A T C missense Het probably benign 0.000 phenotype 10/07/2019
57 577580 UTSW Taf1b 0.954 R7449 G1 175.01 N 12 24504993 I55T T C missense Het probably benign 0.332 phenotype 10/07/2019
58 577542 UTSW Tchh 0.073 R7449 G1 189.46 N 3 93446708 CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC small deletion Het probably benign 10/07/2019
59 577562 UTSW Tenm4 1.000 R7449 G1 225.01 N 7 96874213 D1654V A T missense Het possibly damaging 0.655 phenotype 10/07/2019
60 577558 UTSW Tgfb1 0.808 R7449 G1 225.01 N 7 25704838 V357M G A missense Het probably damaging 1.000 phenotype 10/07/2019
61 577605 UTSW Tnxb 0.000 R7449 G1 225.01 N 17 34703361 P2383S C T missense Het possibly damaging 0.930 phenotype 10/07/2019
62 577559 UTSW Trpm1 0.000 R7449 G1 225.01 N 7 64208975 M382L A T missense Het probably benign 0.143 phenotype 10/07/2019
63 577550 UTSW Trrap 1.000 R7449 G1 225.01 N 5 144851209 Y3516C A G missense Het probably damaging 0.999 phenotype 10/07/2019
64 577575 UTSW Txnrd1 1.000 R7449 G1 225.01 N 10 82885233 Y494* T A nonsense Het probably null phenotype 10/07/2019
65 577607 UTSW Ubr2 0.900 R7449 G1 189.01 N 17 46964788 E811K C T missense Het probably damaging 1.000 phenotype 10/07/2019
66 577538 UTSW Ubxn4 0.401 R7449 G1 225.01 N 1 128244543 F25I T A missense Het possibly damaging 0.880 phenotype 10/07/2019
67 577602 UTSW Vmn2r117 0.368 R7449 G1 225.01 N 17 23459895 M785T A G missense Het probably damaging 0.997 10/07/2019
68 577601 UTSW Vmn2r99 0.117 R7449 G1 225.01 N 17 19379145 D364N G A missense Het probably benign 0.007 10/07/2019
69 577543 UTSW Vps45 0.911 R7449 G1 225.01 N 3 96047136 C A critical splice acceptor site Het probably null phenotype 10/07/2019
70 577584 UTSW Wdr25 0.926 R7449 G1 225.01 N 12 109026441 H426P A C missense Het probably damaging 0.999 10/07/2019
71 577568 UTSW Wdr83 1.000 R7449 G1 225.01 N 8 85079681 W136R A T missense Het probably damaging 1.000 phenotype 10/07/2019
72 577564 UTSW Xylt1 0.179 R7449 G1 225.01 N 7 117592005 I343L A C missense Het possibly damaging 0.546 phenotype 10/07/2019
73 577606 UTSW Znrd1as 0.138 R7449 G1 225.01 N 17 36964383 D16G A G missense Het probably damaging 1.000 10/07/2019
74 577556 UTSW Zscan4b 0.100 R7449 G1 225.01 N 7 10904058 Q53R T C missense Het possibly damaging 0.946 10/07/2019
[records 1 to 74 of 74]