Incidental Mutations

89 incidental mutations are currently displayed, and affect 87 genes.
20 are Possibly Damaging.
25 are Probably Damaging.
33 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 89 of 89] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 578028 UTSW 2510002D24Rik R7454 G1 225.01 N 16 18836851 E57G A G missense Het possibly damaging 0.872 10/07/2019
2 577959 UTSW 4932414N04Rik 0.000 R7454 G1 225.01 N 2 68688304 T159K C A missense Het unknown 10/07/2019
3 578033 UTSW Adamts10 0.425 R7454 G1 225.01 N 17 33545005 F616L T A missense Het possibly damaging 0.894 phenotype 10/07/2019
4 578024 UTSW Adtrp 0.000 R7454 G1 225.01 N 13 41828315 S26L G A missense Het unknown 10/07/2019
5 577991 UTSW Alpk3 0.402 R7454 G1 225.01 N 7 81078562 E480A A C missense Het probably benign 0.021 phenotype 10/07/2019
6 577972 UTSW Anks6 1.000 R7454 G1 225.01 N 4 47038919 T529A T C missense Het unknown phenotype 10/07/2019
7 578016 UTSW Arl4d 0.000 R7454 G1 225.01 N 11 101666660 H4R A G missense Het probably benign 0.081 phenotype 10/07/2019
8 577970 UTSW Ash1l 1.000 R7454 G1 225.01 N 3 88983865 H1017R A G missense Het probably benign 0.163 phenotype 10/07/2019
9 577967 UTSW Bbs12 0.077 R7454 G1 225.01 N 3 37320953 S517P T C missense Het possibly damaging 0.946 phenotype 10/07/2019
10 578021 UTSW Bcl11b 1.000 R7454 G1 212.01 N 12 107916208 R616L C A missense Het possibly damaging 0.930 phenotype 10/07/2019
11 578001 UTSW Bean1 0.000 R7454 G1 225.01 N 8 104211026 G79D G A missense Het probably damaging 1.000 phenotype 10/07/2019
12 577990 UTSW Bicra 0.168 R7454 G1 225.01 N 7 15972134 G1461R C G missense Het probably benign 0.298 10/07/2019
13 578019 UTSW Bptf 1.000 R7454 G1 225.01 N 11 107044640 T124A T C missense Het probably benign 0.033 phenotype 10/07/2019
14 578034 UTSW Btnl4 0.000 R7454 G1 225.01 N 17 34472374 V312E A T missense Het probably benign 0.000 10/07/2019
15 578003 UTSW Ccdc7a 0.055 R7454 G1 225.01 N 8 128944516 M503T A G missense Het unknown 10/07/2019
16 578013 UTSW Celf5 0.123 R7454 G1 225.01 N 10 81482523 E28G T C missense Het probably damaging 0.996 phenotype 10/07/2019
17 578000 UTSW Cilp2 0.000 R7454 G1 225.01 N 8 69883390 L350F G A missense Het probably damaging 1.000 10/07/2019
18 577987 UTSW Clec4a2 0.052 R7454 G1 225.01 N 6 123142452 I245T T C missense Het probably damaging 0.980 phenotype 10/07/2019
19 577973 UTSW Ctnnal1 0.217 R7454 G1 225.01 N 4 56844544 V140D A T missense Het probably damaging 0.998 phenotype 10/07/2019
20 578008 UTSW Dennd4a 0.317 R7454 G1 225.01 N 9 64852570 H319P A C missense Het probably damaging 1.000 phenotype 10/07/2019
21 577974 UTSW Dlgap3 0.117 R7454 G1 225.01 N 4 127235059 L857F G T missense Het probably null 0.012 phenotype 10/07/2019
22 577986 UTSW Dnah6 0.164 R7454 G1 225.01 N 6 73212492 T58S T A missense Het probably damaging 0.997 phenotype 10/07/2019
23 577953 UTSW Dnah7a 0.135 R7454 G1 225.01 N 1 53518764 M2164L T A missense Het probably benign 0.000 10/07/2019
24 577980 UTSW Dspp 0.000 R7454 G1 225.01 N 5 104175610 H206Q T A missense Het probably benign 0.008 phenotype 10/07/2019
25 578010 UTSW Dzip1l 0.260 R7454 G1 225.01 N 9 99659674 V443M G A missense Het possibly damaging 0.587 10/07/2019
26 578026 UTSW Erc2 0.000 R7454 G1 225.01 N 14 28302991 H939R A G missense Het possibly damaging 0.915 phenotype 10/07/2019
27 577999 UTSW Fam149a 0.000 R7454 G1 225.01 N 8 45348546 H513N G T missense Het probably benign 0.294 10/07/2019
28 578017 UTSW Fam171a2 0.141 R7454 G1 225.01 N 11 102439717 T280A T C missense Het possibly damaging 0.877 10/07/2019
29 578023 UTSW Fam208b 0.104 R7454 G1 225.01 N 13 3585332 S492P A G missense Het probably benign 0.213 10/07/2019
30 578032 UTSW Fkbp5 0.000 R7454 G1 225.01 N 17 28416025 V170G A C missense Het probably damaging 0.966 phenotype 10/07/2019
31 577964 UTSW Fnbp4 0.906 R7454 G1 217.47 N 2 90777815 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC unclassified Het probably benign 10/07/2019
32 577965 UTSW Fnbp4 0.906 R7454 G1 179.47 N 2 90777818 ACC ACCCCCCCC unclassified Het probably benign 10/07/2019
33 578018 UTSW Fzd2 0.414 R7454 G1 225.01 N 11 102605129 F133S T C missense Het probably damaging 0.999 phenotype 10/07/2019
34 578037 UTSW Galm 0.096 R7454 G1 225.01 N 17 80138121 N100S A G missense Het possibly damaging 0.761 phenotype 10/07/2019
35 577971 UTSW Gbp2b 0.000 R7454 G1 225.01 N 3 142598159 I5N T A missense Het possibly damaging 0.754 phenotype 10/07/2019
36 577994 UTSW Gga2 1.000 R7454 G1 225.01 N 7 122002146 R245G T C missense Het probably benign 0.003 phenotype 10/07/2019
37 578039 UTSW Gm10053 R7454 G1 210.01 N 19 24875900 T50A A G missense Het probably benign 0.051 10/07/2019
38 578005 UTSW Gm1110 0.086 R7454 G1 225.01 N 9 26920649 T69A T C missense Het probably benign 0.000 10/07/2019
39 577988 UTSW Gm15922 0.064 R7454 G1 225.01 N 7 3735510 E622D T G missense Het probably benign 0.027 10/07/2019
40 578020 UTSW Heatr5a 0.293 R7454 G1 225.01 N 12 51961543 S6G T C missense Het probably benign 0.201 10/07/2019
41 577956 UTSW Hmcn1 0.000 R7454 G1 225.01 N 1 150563604 S5610P A G missense Het probably damaging 0.996 phenotype 10/07/2019
42 577975 UTSW Hmgb4 0.212 R7454 G1 225.01 N 4 128260406 V123A A G missense Het probably damaging 1.000 10/07/2019
43 577995 UTSW Itgal 0.157 R7454 G1 225.01 N 7 127327764 Q943K C A missense Het probably benign 0.002 phenotype 10/07/2019
44 577979 UTSW Jakmip1 0.596 R7454 G1 225.01 N 5 37175154 D1059E C A missense Het probably damaging 0.964 phenotype 10/07/2019
45 577998 UTSW Kat6a 1.000 R7454 G1 225.01 N 8 22935772 E1111G A G missense Het possibly damaging 0.565 phenotype 10/07/2019
46 578035 UTSW Kdm4b 0.000 R7454 G1 225.01 N 17 56389639 P452T C A missense Het probably benign 0.001 phenotype 10/07/2019
47 577978 UTSW Krit1 1.000 R7454 G1 225.01 N 5 3812474 Y210H T C missense Het probably damaging 0.988 phenotype 10/07/2019
48 578030 UTSW Krtap6-2 0.097 R7454 G1 225.01 N 16 89419912 Y56N A T missense Het unknown 10/07/2019
49 577989 UTSW Lig1 1.000 R7454 G1 225.01 N 7 13288721 D158V A T missense Het probably damaging 0.988 phenotype 10/07/2019
50 577993 UTSW Lmo1 0.679 R7454 G1 216.01 N 7 109140666 L94Q A T missense Het probably benign 0.029 phenotype 10/07/2019
51 578036 UTSW Lrrc30 0.000 R7454 G1 225.01 N 17 67632243 L114H A T missense Het probably damaging 0.973 10/07/2019
52 578029 UTSW Ltn1 1.000 R7454 G1 225.01 N 16 87397812 I1400V T C missense Het probably benign 0.033 phenotype 10/07/2019
53 578022 UTSW Mark3 0.318 R7454 G1 225.01 N 12 111604527 I87T T C missense Het probably damaging 1.000 phenotype 10/07/2019
54 578007 UTSW Mfrp 0.218 R7454 G1 225.01 N 9 44105183 V392F G T missense Het possibly damaging 0.899 phenotype 10/07/2019
55 577997 UTSW Mrgprg 0.055 R7454 G1 225.01 N 7 143765135 L80P A G missense Het probably damaging 1.000 10/07/2019
56 578011 UTSW Ndufaf3 0.860 R7454 G1 225.01 N 9 108566926 M1K A T start codon destroyed Het probably null 0.691 phenotype 10/07/2019
57 577957 UTSW Nme7 0.707 R7454 G1 225.01 N 1 164380648 L295* T A nonsense Het probably null phenotype 10/07/2019
58 577968 UTSW Noct 0.141 R7454 G1 225.01 N 3 51249730 C163F G T missense Het probably damaging 1.000 phenotype 10/07/2019
59 577963 UTSW Olfr1270 0.089 R7454 G1 225.01 N 2 90149419 I196F T A missense Het possibly damaging 0.780 phenotype 10/07/2019
60 578006 UTSW Olfr229 0.114 R7454 G1 225.01 N 9 39909904 I34V A G missense Het probably benign 0.022 phenotype 10/07/2019
61 577996 UTSW Olfr541 0.080 R7454 G1 225.01 N 7 140704634 I128F A T missense Het probably damaging 1.000 phenotype 10/07/2019
62 578027 UTSW Olfr747 0.079 R7454 G1 225.01 N 14 50680824 Q270L T A missense Het possibly damaging 0.939 phenotype 10/07/2019
63 578014 UTSW Olfr772 R7454 G1 225.01 N 10 129174455 T189S T A missense Het probably damaging 1.000 phenotype 10/07/2019
64 577962 UTSW Olfr992 0.071 R7454 G1 225.01 N 2 85399611 K307N T A missense Het probably damaging 0.985 phenotype 10/07/2019
65 577977 UTSW Per3 0.155 R7454 G1 225.01 N 4 151012728 L780P A G missense Het probably benign 0.051 phenotype 10/07/2019
66 577955 UTSW Pla2g4a 0.238 R7454 G1 225.01 N 1 149872690 M256V T C missense Het possibly damaging 0.626 phenotype 10/07/2019
67 578040 UTSW Pnliprp1 0.111 R7454 G1 225.01 N 19 58741100 K395R A G missense Het probably benign 0.292 10/07/2019
68 578025 UTSW Poc5 0.000 R7454 G1 225.01 N 13 96400832 G242V G T missense Het possibly damaging 0.928 10/07/2019
69 577954 UTSW Ppfia4 0.135 R7454 G1 225.01 N 1 134324135 S434P A G missense Het possibly damaging 0.871 10/07/2019
70 578012 UTSW Prss42 0.059 R7454 G1 225.01 N 9 110798829 N110S A G missense Het probably benign 0.004 10/07/2019
71 577966 UTSW Ralgapb 1.000 R7454 G1 225.01 N 2 158432902 I241N T A missense Het possibly damaging 0.937 10/07/2019
72 577984 UTSW Rbak 0.398 R7454 G1 225.01 N 5 143173773 Y508* A C nonsense Het probably null phenotype 10/07/2019
73 578004 UTSW S1pr2 0.213 R7454 G1 225.01 N 9 20967549 R328S G T missense Het possibly damaging 0.745 phenotype 10/07/2019
74 578038 UTSW Sap130 0.959 R7454 G1 225.01 N 18 31650512 M214T T C missense Het probably benign 0.015 phenotype 10/07/2019
75 578015 UTSW Slc46a1 0.000 R7454 G1 225.01 N 11 78466511 V130E T A missense Het probably damaging 0.974 phenotype 10/07/2019
76 577969 UTSW Smc4 0.967 R7454 G1 225.01 N 3 69018124 H343L A T missense Het probably benign 0.000 phenotype 10/07/2019
77 578002 UTSW Tarbp1 0.000 R7454 G1 225.01 N 8 126457677 R500L C A missense Het probably benign 0.185 phenotype 10/07/2019
78 577981 UTSW Tgfbr3 1.000 R7454 G1 225.01 N 5 107215028 H39Q A T missense Het probably damaging 1.000 phenotype 10/07/2019
79 577952 UTSW Tpp2 0.689 R7454 G1 225.01 N 1 43954659 S235P T C missense Het probably benign 0.007 phenotype 10/07/2019
80 577985 UTSW Trbc2 0.102 R7454 G1 225.01 N 6 41546829 R33M G T missense Het 10/07/2019
81 577992 UTSW Trim3 0.000 R7454 G1 225.01 N 7 105619558 R63Q C T missense Het probably damaging 0.999 phenotype 10/07/2019
82 577982 UTSW Ttc28 0.000 R7454 G1 225.01 N 5 111285484 V2128A T C missense Het probably benign 0.195 10/07/2019
83 577960 UTSW Ttn 1.000 R7454 G1 225.01 N 2 76725818 R30281H C T missense Het probably damaging 1.000 phenotype 10/07/2019
84 577961 UTSW Ttn 1.000 R7454 G1 225.01 N 2 76944139 Q2187L T A missense Het unknown phenotype 10/07/2019
85 577983 UTSW Ttyh3 0.123 R7454 G1 225.01 N 5 140629425 S403G T C missense Het possibly damaging 0.946 phenotype 10/07/2019
86 578031 UTSW Vmn2r112 0.140 R7454 G1 225.01 N 17 22603307 D322V A T missense Het probably benign 0.002 10/07/2019
87 577958 UTSW Wdr38 0.075 R7454 G1 211.01 N 2 38998340 C T start gained Het probably benign 10/07/2019
88 578009 UTSW Xrn1 0.900 R7454 G1 225.01 N 9 96048358 S1543R T A missense Het probably benign 0.030 phenotype 10/07/2019
89 577976 UTSW Zbtb8b 0.285 R7454 G1 225.01 N 4 129432769 T201I G A missense Het possibly damaging 0.754 10/07/2019
[records 1 to 89 of 89]