Incidental Mutations

49 incidental mutations are currently displayed, and affect 49 genes.
9 are Possibly Damaging.
15 are Probably Damaging.
17 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 49 of 49] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 578244 UTSW 2900026A02Rik 0.065 R7458 G1 225.01 Y 5 113190644 V501M C T missense Het probably benign 0.051 10/07/2019
2 578269 UTSW 3632451O06Rik 0.000 R7458 G1 225.01 Y 14 49682739 Y711C T C missense Het probably damaging 1.000 10/07/2019
3 578259 UTSW Abca13 0.000 R7458 G1 225.01 Y 11 9290777 F880S T C missense Het possibly damaging 0.935 phenotype 10/07/2019
4 578235 UTSW AI182371 0.061 R7458 G1 225.01 Y 2 35086504 R206S T A missense Het possibly damaging 0.946 10/07/2019
5 578242 UTSW Akr1a1 0.337 R7458 G1 225.01 Y 4 116637817 M286K A T missense Het possibly damaging 0.614 0.875 phenotype 10/07/2019
6 578257 UTSW Aldh8a1 0.077 R7458 G1 225.01 Y 10 21395593 E406G A G missense Het possibly damaging 0.948 phenotype 10/07/2019
7 578237 UTSW Ambra1 0.895 R7458 G1 225.01 Y 2 91917684 V1255D T A missense Het probably benign 0.257 phenotype 10/07/2019
8 578271 UTSW Apol7e 0.067 R7458 G1 225.01 Y 15 77714404 T23I C T missense Het probably benign 0.199 10/07/2019
9 578273 UTSW Boc 0.000 R7458 G1 225.01 Y 16 44486756 E1034G T C missense Het phenotype 10/07/2019
10 578275 UTSW Bricd5 R7458 G1 225.01 Y 17 24474502 I39T T C missense Het probably damaging 0.977 10/07/2019
11 578248 UTSW Ccne1 0.000 R7458 G1 225.01 Y 7 38100671 T163A T C missense Het probably damaging 0.995 phenotype 10/07/2019
12 578247 UTSW Cct7 0.949 R7458 G1 225.01 Y 6 85459996 V72A T C missense Het probably benign 0.141 0.100 phenotype 10/07/2019
13 578253 UTSW Cdh3 0.208 R7458 G1 225.01 Y 8 106537147 D199G A G missense Het probably damaging 0.998 phenotype 10/07/2019
14 578245 UTSW Clip1 0.000 R7458 G1 225.01 Y 5 123640546 E438A T G missense Het probably damaging 0.999 phenotype 10/07/2019
15 578234 UTSW Col4a4 0.103 R7458 G1 225.01 Y 1 82498948 I553M T C missense Het unknown phenotype 10/07/2019
16 578251 UTSW Csmd1 0.000 R7458 G1 225.01 Y 8 15953738 N2605K A T missense Het probably damaging 0.997 phenotype 10/07/2019
17 605512 UTSW Dnajc10 0.310 R7458 G1 225.01 Y 2 80324750 T A splice site 8 bp Het probably null phenotype 12/09/2019
18 578238 UTSW Fbn1 0.921 R7458 G1 225.01 Y 2 125319116 D2168V T A missense Het probably benign 0.145 phenotype 10/07/2019
19 578262 UTSW G2e3 0.683 R7458 G1 225.01 Y 12 51365507 N443K T A missense Het possibly damaging 0.667 phenotype 10/07/2019
20 578243 UTSW Gak 1.000 R7458 G1 225.01 Y 5 108583074 D822G T C missense Het probably benign 0.001 phenotype 10/07/2019
21 578279 UTSW Gm9493 R7458 G1 225.01 Y 19 23619913 I58V A G missense Het probably benign 0.002 10/07/2019
22 578265 UTSW Gpr65 0.000 R7458 G1 225.01 Y 12 98276065 S326A T G missense Het probably damaging 0.992 phenotype 10/07/2019
23 578250 UTSW Irs2 0.552 R7458 G1 225.01 Y 8 11007739 E231G T C missense Het probably damaging 0.987 phenotype 10/07/2019
24 578267 UTSW Itga1 0.489 R7458 G1 225.01 Y 13 114986266 D718G T C missense Het probably benign 0.003 phenotype 10/07/2019
25 578268 UTSW Itih1 0.080 R7458 G1 225.01 Y 14 30943266 M1V T C start codon destroyed Het probably null phenotype 10/07/2019
26 578258 UTSW Lgr5 1.000 R7458 G1 225.01 Y 10 115457755 A G critical splice donor site 2 bp Het probably null phenotype 10/07/2019
27 578280 UTSW Lipn 0.000 R7458 G1 225.01 Y 19 34071842 N136S A G missense Het probably benign 0.103 phenotype 10/07/2019
28 578261 UTSW Lrrc37a 0.132 R7458 G1 225.01 Y 11 103497432 T2389I G A missense Het unknown 10/07/2019
29 578278 UTSW Myo7b 0.000 R7458 G1 225.01 Y 18 31988551 A767V G A missense Het possibly damaging 0.886 phenotype 10/07/2019
30 578240 UTSW Necab1 0.140 R7458 G1 225.01 Y 4 15111244 S61R A T missense Het possibly damaging 0.897 10/07/2019
31 578236 UTSW Olfr1031 0.082 R7458 G1 225.01 Y 2 85992650 T278A A G missense Het probably damaging 0.999 phenotype 10/07/2019
32 578270 UTSW Phyhip 0.075 R7458 G1 225.01 Y 14 70461820 R21H G A missense Het probably damaging 0.963 10/07/2019
33 578255 UTSW Pls1 0.151 R7458 G1 225.01 Y 9 95785507 T116I G A missense Het probably damaging 0.999 phenotype 10/07/2019
34 578263 UTSW Pnn 1.000 R7458 G1 225.01 Y 12 59072414 S594R C A missense Het unknown phenotype 10/07/2019
35 578264 UTSW Psen1 1.000 R7458 G1 225.01 Y 12 83714766 I114N T A missense Het probably damaging 1.000 phenotype 10/07/2019
36 578281 UTSW Rhox8 R7458 G1 191.53 N X 37878114 GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT small insertion Het probably benign 10/07/2019
37 578266 UTSW Slc12a7 0.000 R7458 G1 225.01 Y 13 73785069 V82E T A missense Het probably damaging 0.998 0.369 phenotype 10/07/2019
38 578239 UTSW Slc25a44 0.197 R7458 G1 225.01 Y 3 88416061 I246T A G missense Het probably benign 0.139 phenotype 10/07/2019
39 578272 UTSW Slc2a13 0.000 R7458 G1 225.01 Y 15 91412187 Y308F T A missense Het probably benign 0.038 10/07/2019
40 578254 UTSW Sntb2 0.621 R7458 G1 225.01 Y 8 106936298 A166E C A missense Het possibly damaging 0.835 phenotype 10/07/2019
41 578246 UTSW Tas2r135 0.056 R7458 G1 225.01 Y 6 42405947 V140D T A missense Het possibly damaging 0.955 10/07/2019
42 578277 UTSW Tdrd6 0.000 R7458 G1 225.01 Y 17 43625046 T1704A T C missense Het probably benign 0.016 phenotype 10/07/2019
43 578241 UTSW Txndc12 0.173 R7458 G1 225.01 Y 4 108861409 D159G A G missense Het probably benign 0.000 0.083 phenotype 10/07/2019
44 578276 UTSW Ubash3a 0.000 R7458 G1 225.01 Y 17 31208165 L16P T C missense Het probably benign 0.018 phenotype 10/07/2019
45 578256 UTSW Usp4 0.141 R7458 G1 225.01 Y 9 108367856 L331P T C missense Het probably damaging 1.000 0.967 phenotype 10/07/2019
46 578274 UTSW Vmn2r108 0.074 R7458 G1 225.01 Y 17 20472270 D108G T C missense Het probably benign 0.168 10/07/2019
47 578249 UTSW Vmn2r58 0.379 R7458 G1 225.01 Y 7 41837699 A591S C A missense Het probably benign 0.056 10/07/2019
48 578260 UTSW Wdpcp 0.207 R7458 G1 225.01 Y 11 21748919 I566T T C missense Het probably damaging 0.972 phenotype 10/07/2019
49 578252 UTSW Zfp866 0.088 R7458 G1 225.01 Y 8 69765552 K473* T A nonsense Het probably null 0.976 10/07/2019
[records 1 to 49 of 49]