Incidental Mutations

62 incidental mutations are currently displayed, and affect 62 genes.
11 are Possibly Damaging.
19 are Probably Damaging.
23 are Probably Benign.
8 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 578590 UTSW Abcc10 0.083 R7463 G1 225.01 Y 17 46323772 V435E A T missense Het probably damaging 0.999 phenotype 10/07/2019
2 578596 UTSW Acta2 0.299 R7463 G1 225.01 Y 19 34252531 T8I G A missense Het probably benign 0.001 0.103 phenotype 10/07/2019
3 578581 UTSW Adcy2 0.000 R7463 G1 225.01 Y 13 68730280 D413G T C missense Het probably damaging 1.000 phenotype 10/07/2019
4 578566 UTSW Adgrg6 1.000 R7463 G1 225.01 Y 10 14434396 D727V T A missense Het possibly damaging 0.822 0.115 phenotype 10/07/2019
5 578556 UTSW Aebp2 1.000 R7463 G1 196.01 Y 6 140637726 Q309* C T nonsense Het probably null 0.976 phenotype 10/07/2019
6 578546 UTSW Amy1 0.142 R7463 G1 225.01 Y 3 113569884 C43* A T nonsense Het probably null phenotype 10/07/2019
7 578570 UTSW Bpifc 0.090 R7463 G1 225.01 Y 10 85979334 E256G T C missense Het probably benign 0.003 10/07/2019
8 578591 UTSW Bysl 1.000 R7463 G1 225.01 Y 17 47602471 S296T A T missense Het probably benign 0.255 0.237 phenotype 10/07/2019
9 578583 UTSW Carmil3 0.347 R7463 G1 225.01 Y 14 55502396 P980L C T missense Het probably damaging 0.999 10/07/2019
10 578579 UTSW Coch 0.000 R7463 G1 190.01 Y 12 51593625 M1K T A start codon destroyed Het probably null 0.024 phenotype 10/07/2019
11 578548 UTSW Cpt2 0.199 R7463 G1 225.01 Y 4 107908157 F137I A T missense Het probably damaging 0.998 phenotype 10/07/2019
12 578592 UTSW Crem 0.511 R7463 G1 225.01 Y 18 3295094 I112V T C missense Het probably benign 0.060 phenotype 10/07/2019
13 605553 UTSW Cul9 0.337 R7463 G1 225.01 Y 17 46520476 A G splice site 6 bp Het probably null phenotype 12/13/2019
14 578553 UTSW Cyp3a41a 0.174 R7463 G1 225.01 Y 5 145713564 I90F T A missense Het probably damaging 1.000 0.658 10/07/2019
15 578589 UTSW Cyp4f16 0.000 R7463 G1 225.01 Y 17 32550787 A457V C T missense Het possibly damaging 0.895 0.506 10/07/2019
16 578565 UTSW Ddx6 1.000 R7463 G1 225.01 Y 9 44628729 E318G A G missense Het probably damaging 0.998 phenotype 10/07/2019
17 578586 UTSW Dip2b 0.661 R7463 G1 225.01 Y 15 100154157 E213G A G missense Het probably benign 0.000 phenotype 10/07/2019
18 578554 UTSW Dlx5 1.000 R7463 G1 225.01 Y 6 6878316 H238R T C missense Het probably damaging 0.999 phenotype 10/07/2019
19 578577 UTSW Dnaic2 0.102 R7463 G1 225.01 Y 11 114754406 I556L A C missense Het probably benign 0.071 0.072 phenotype 10/07/2019
20 578563 UTSW Dnmt1 1.000 R7463 G1 225.01 Y 9 20912225 V1147M C T missense Het possibly damaging 0.858 0.742 phenotype 10/07/2019
21 578547 UTSW Egf 0.000 R7463 G1 225.01 Y 3 129740015 Q59K G T missense Het probably benign 0.394 phenotype 10/07/2019
22 578595 UTSW Ermp1 0.000 R7463 G1 225.01 Y 19 29646262 Y109* A T nonsense Het probably null phenotype 10/07/2019
23 578584 UTSW Fer1l6 0.081 R7463 G1 225.01 Y 15 58573601 Y573* T A nonsense Het probably null 10/07/2019
24 578576 UTSW Fmnl1 0.125 R7463 G1 225.01 Y 11 103193128 L503P T C missense Het probably damaging 0.999 0.079 phenotype 10/07/2019
25 578571 UTSW Gnptab 0.936 R7463 G1 225.01 Y 10 88431389 I447M T G missense Het probably damaging 0.995 phenotype 10/07/2019
26 578550 UTSW Hgf 1.000 R7463 G1 225.01 Y 5 16578450 D253N G A missense Het probably benign 0.002 phenotype 10/07/2019
27 578539 UTSW Hjurp 0.869 R7463 G1 217.47 Y 1 88266277 CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C utr 3 prime Het probably benign 10/07/2019
28 578587 UTSW Igf2r 0.917 R7463 G1 225.01 Y 17 12710645 T958A T C missense Het probably benign 0.158 0.085 phenotype 10/07/2019
29 578555 UTSW Kcnd2 0.114 R7463 G1 225.01 Y 6 21216498 L67Q T A missense Het probably damaging 1.000 phenotype 10/07/2019
30 578572 UTSW Kif5a 1.000 R7463 G1 215.01 Y 10 127243724 V248A A G missense Het probably damaging 0.973 phenotype 10/07/2019
31 578575 UTSW Krt33b 0.073 R7463 G1 225.01 Y 11 100029563 I88T A G missense Het probably damaging 1.000 0.838 10/07/2019
32 578542 UTSW Lhx2 1.000 R7463 G1 199.01 Y 2 38351846 E25K G A missense Het possibly damaging 0.545 phenotype 10/07/2019
33 578569 UTSW Mex3d 0.279 R7463 G1 131.01 Y 10 80381698 G562R C T missense Het 0.083 10/07/2019
34 578561 UTSW Myom2 0.101 R7463 G1 225.01 Y 8 15117679 Y1088F A T missense Het probably null 0.944 phenotype 10/07/2019
35 605551 UTSW Ncapg 0.950 R7463 G1 92.01 Y 5 45694092 T A intron 166 bp Het probably null phenotype 12/13/2019
36 578549 UTSW Nudc 0.958 R7463 G1 225.01 Y 4 133534403 V190G A C missense Het possibly damaging 0.902 phenotype 10/07/2019
37 578574 UTSW Obscn 0.687 R7463 G1 225.01 Y 11 59122860 R1054S G T missense Het probably benign 0.017 phenotype 10/07/2019
38 578544 UTSW Olfr1045 0.184 R7463 G1 225.01 Y 2 86197838 M305V T C missense Het probably benign 0.000 phenotype 10/07/2019
39 578582 UTSW Olfr1510 0.000 R7463 G1 225.01 Y 14 52410711 W54R A G missense Het probably benign 0.001 phenotype 10/07/2019
40 578557 UTSW Olfr651 0.076 R7463 G1 193.01 Y 7 104553482 S188P T C missense Het possibly damaging 0.880 0.179 phenotype 10/07/2019
41 578558 UTSW Olfr683 0.068 R7463 G1 225.01 Y 7 105143937 M119L T A missense Het probably benign 0.002 phenotype 10/07/2019
42 578559 UTSW Olfr710 0.057 R7463 G1 225.01 Y 7 106944173 V276E A T missense Het probably damaging 0.993 phenotype 10/07/2019
43 578564 UTSW Olfr979 0.069 R7463 G1 225.01 Y 9 40000564 V221A A G missense Het probably benign 0.066 0.220 phenotype 10/07/2019
44 578545 UTSW Pcdh10 0.192 R7463 G1 204.01 Y 3 45383572 R891S A T missense Het possibly damaging 0.594 0.072 phenotype 10/07/2019
45 578567 UTSW Pcdh15 0.000 R7463 G1 225.01 Y 10 74631770 S1873L C T missense Het possibly damaging 0.663 phenotype 10/07/2019
46 578552 UTSW Pcdh7 0.241 R7463 G1 225.01 Y 5 57720998 K632E A G missense Het probably benign 0.058 phenotype 10/07/2019
47 578593 UTSW Pcdhgb8 0.107 R7463 G1 225.01 Y 18 37763427 A517T G A missense Het probably damaging 0.999 10/07/2019
48 578580 UTSW Ptgr2 0.213 R7463 G1 176.01 Y 12 84292298 A T start gained Het probably benign phenotype 10/07/2019
49 578538 UTSW Ptpn18 0.104 R7463 G1 225.01 Y 1 34473364 D417N G A missense Het possibly damaging 0.754 0.179 phenotype 10/07/2019
50 578585 UTSW Racgap1 1.000 R7463 G1 225.01 Y 15 99642958 T4S T A missense Het probably benign 0.000 phenotype 10/07/2019
51 578537 UTSW Rb1cc1 1.000 R7463 G1 225.01 Y 1 6249180 H941R A G missense Het probably benign 0.000 phenotype 10/07/2019
52 578551 UTSW Reln 0.947 R7463 G1 225.01 Y 5 22103435 H312R T C missense Het probably damaging 0.976 phenotype 10/07/2019
53 578562 UTSW Rnf166 R7463 G1 225.01 Y 8 122467987 H208L T A missense Het probably damaging 0.985 10/07/2019
54 578568 UTSW Theg 0.000 R7463 G1 225.01 Y 10 79576715 E314G T C missense Het probably damaging 0.988 phenotype 10/07/2019
55 578573 UTSW Timeless 1.000 R7463 G1 225.01 Y 10 128250426 S999P T C missense Het probably benign 0.004 phenotype 10/07/2019
56 578578 UTSW Tmem94 0.187 R7463 G1 203.01 Y 11 115786256 R118L G T missense Het possibly damaging 0.535 0.304 10/07/2019
57 578540 UTSW Tor1aip1 1.000 R7463 G1 225.01 Y 1 156007609 H349Q A T missense Het possibly damaging 0.484 phenotype 10/07/2019
58 578543 UTSW Ttn 1.000 R7463 G1 225.01 Y 2 76920460 E3415V T A missense Het probably benign 0.048 phenotype 10/07/2019
59 578588 UTSW Vmn2r102 0.000 R7463 G1 225.01 Y 17 19676624 N78Y A T missense Het probably damaging 1.000 0.633 10/07/2019
60 578560 UTSW Wdr11 0.177 R7463 G1 225.01 Y 7 129607086 D427V A T missense Het probably damaging 0.988 phenotype 10/07/2019
61 578541 UTSW Zer1 0.162 R7463 G1 225.01 Y 2 30113437 A T start gained Het probably benign 0.090 phenotype 10/07/2019
62 578594 UTSW Zfp516 0.438 R7463 G1 197.01 Y 18 82957108 M477K T A missense Het probably benign 0.075 phenotype 10/07/2019
[records 1 to 62 of 62]