Incidental Mutations

86 incidental mutations are currently displayed, and affect 86 genes.
17 are Possibly Damaging.
23 are Probably Damaging.
30 are Probably Benign.
11 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 578626 UTSW Aass 0.000 R7464 G1 225.01 Y 6 23077153 G736R C T missense Het possibly damaging 0.695 phenotype 10/07/2019
2 578679 UTSW Acta2 0.237 R7464 G1 225.01 Y 19 34252531 T8I G A missense Het probably benign 0.001 0.103 phenotype 10/07/2019
3 578599 UTSW Ankar 0.061 R7464 G1 225.01 Y 1 72698894 V43E A T missense Het possibly damaging 0.942 10/07/2019
4 578651 UTSW Apof R7464 G1 225.01 Y 10 128269636 I220V A G missense Het probably benign 0.214 phenotype 10/07/2019
5 578611 UTSW Asxl1 1.000 R7464 G1 225.01 Y 2 153397785 A499S G T missense Het probably benign 0.015 phenotype 10/07/2019
6 578650 UTSW Baz2a 0.000 R7464 G1 225.01 Y 10 128122073 D1069E T A missense Het possibly damaging 0.805 10/07/2019
7 578608 UTSW Baz2b 0.382 R7464 G1 225.01 Y 2 59977448 T156A T C missense Het possibly damaging 0.528 phenotype 10/07/2019
8 578632 UTSW Bbc3 0.000 R7464 G1 225.01 Y 7 16317157 R169W A T missense Het unknown 0.382 phenotype 10/07/2019
9 578631 UTSW C5ar1 0.144 R7464 G1 225.01 Y 7 16248766 I110L T A missense Het probably benign 0.066 0.090 phenotype 10/07/2019
10 578624 UTSW C87414 0.085 R7464 G1 181.01 N 5 93636240 C455Y C T missense Het probably damaging 1.000 10/07/2019
11 578635 UTSW Cd19 0.802 R7464 G1 225.01 Y 7 126411803 R323L C A missense Het probably damaging 1.000 phenotype 10/07/2019
12 578664 UTSW Cdc14b 0.310 R7464 G1 225.01 Y 13 64196675 C113* A T nonsense Het probably null 0.976 phenotype 10/07/2019
13 578642 UTSW Cngb1 1.000 R7464 G1 225.01 Y 8 95254183 W914L C A missense Het possibly damaging 0.921 phenotype 10/07/2019
14 578603 UTSW Colgalt2 0.067 R7464 G1 225.01 Y 1 152504144 K445E A G missense Het probably damaging 0.969 10/07/2019
15 578674 UTSW Crebrf 0.577 R7464 G1 225.01 Y 17 26763487 M608V A G missense Het unknown 0.087 phenotype 10/07/2019
16 578617 UTSW Csf1 0.787 R7464 G1 225.01 Y 3 107748875 H280L T A missense Het probably benign 0.031 phenotype 10/07/2019
17 578618 UTSW Cyp2j11 0.059 R7464 G1 225.01 Y 4 96345120 R113L C A missense Het probably damaging 1.000 10/07/2019
18 578622 UTSW D5Ertd579e 0.364 R7464 G1 225.01 Y 5 36613785 H1089Y G A missense Het probably damaging 0.993 10/07/2019
19 578640 UTSW Ddx60 0.229 R7464 G1 225.01 Y 8 61940674 T48M C T missense Het possibly damaging 0.821 0.179 phenotype 10/07/2019
20 578600 UTSW Dock10 0.363 R7464 G1 225.01 Y 1 80540315 D1315G T C missense Het probably damaging 0.985 phenotype 10/07/2019
21 578652 UTSW Dock2 0.000 R7464 G1 225.01 Y 11 34695278 N526H T G missense Het probably damaging 0.993 phenotype 10/07/2019
22 578615 UTSW Dram2 0.000 R7464 G1 225.01 N 3 106573683 *268Q T C makesense Het probably null 10/07/2019
23 578643 UTSW Emc8 1.000 R7464 G1 198.01 Y 8 120667918 Y21H A G missense Het possibly damaging 0.920 10/07/2019
24 578672 UTSW Fam162a 0.000 R7464 G1 215.01 N 16 36071493 L4P A G missense Het probably damaging 1.000 10/07/2019
25 578633 UTSW Fan1 0.000 R7464 G1 225.01 Y 7 64372486 N340Y T A missense Het probably damaging 0.974 0.101 phenotype 10/07/2019
26 578655 UTSW Fbxw10 0.056 R7464 G1 225.01 Y 11 62853298 I307N T A missense Het probably benign 0.014 phenotype 10/07/2019
27 578645 UTSW Fbxw16 0.076 R7464 G1 225.01 Y 9 109439551 V257A A G missense Het possibly damaging 0.505 0.179 10/07/2019
28 615911 UTSW Fer1l6 0.078 R7464 G1 45.01 Y 15 58573247 T A splice site Het probably null 01/13/2020
29 578639 UTSW Galnt7 0.570 R7464 G1 225.01 Y 8 57584020 Y112H A G missense Het possibly damaging 0.947 0.161 phenotype 10/07/2019
30 578601 UTSW Gigyf2 0.947 R7464 G1 225.01 Y 1 87428604 I803T T C missense Het unknown phenotype 10/07/2019
31 578613 UTSW Gm10696 0.922 R7464 G1 210.01 N 3 94176104 N133K A T missense Het probably benign 0.084 10/07/2019
32 578636 UTSW Gm15292 0.208 R7464 G1 225.01 Y 8 21249894 S45T T A missense Het probably damaging 0.972 10/07/2019
33 578644 UTSW Gm28729 0.075 R7464 G1 225.01 N 9 96521235 I44T A G missense Het possibly damaging 0.934 10/07/2019
34 578662 UTSW Gm5447 R7464 G1 225.01 N 13 30974394 I34V A G missense Het not run 10/07/2019
35 615912 UTSW H2-M9 0.063 R7464 G1 225.01 Y 17 36642411 A T splice site Het probably null 01/13/2020
36 578657 UTSW Helz 0.000 R7464 G1 225.01 Y 11 107636278 C864Y G A missense Het probably damaging 0.998 phenotype 10/07/2019
37 578666 UTSW Il25 0.000 R7464 G1 225.01 Y 14 54933222 Y84C A G missense Het probably null 1.000 phenotype 10/07/2019
38 578614 UTSW Itga10 0.107 R7464 G1 225.01 Y 3 96648155 C142S T A missense Het probably damaging 0.999 phenotype 10/07/2019
39 578616 UTSW Kcna10 0.129 R7464 G1 225.01 Y 3 107194079 M9L A T missense Het probably damaging 0.989 phenotype 10/07/2019
40 578670 UTSW Klhl6 0.067 R7464 G1 225.01 Y 16 19957113 Q232K G T missense Het possibly damaging 0.584 phenotype 10/07/2019
41 578671 UTSW Mb21d2 0.000 R7464 G1 225.01 Y 16 28929546 I40L T G missense Het possibly damaging 0.847 0.086 10/07/2019
42 578649 UTSW Mdm1 0.105 R7464 G1 225.01 Y 10 118152266 S334P T C missense Het probably benign 0.001 phenotype 10/07/2019
43 578605 UTSW Mllt10 0.823 R7464 G1 225.01 Y 2 18170279 D549E T A missense Het probably benign 0.000 phenotype 10/07/2019
44 578625 UTSW Mlxipl 0.497 R7464 G1 225.01 Y 5 135133628 V648A T C missense Het probably benign 0.007 phenotype 10/07/2019
45 578634 UTSW Nars2 1.000 R7464 G1 225.01 Y 7 97039930 K353R A G missense Het probably benign 0.398 phenotype 10/07/2019
46 578602 UTSW Nav1 0.915 R7464 G1 225.01 Y 1 135584909 M138L T A missense Het probably benign 0.034 phenotype 10/07/2019
47 578606 UTSW Neb 0.814 R7464 G1 225.01 Y 2 52193890 T5635A T C missense Het probably benign 0.022 phenotype 10/07/2019
48 578646 UTSW Nktr 0.583 R7464 G1 225.01 Y 9 121750327 I1154L A C missense Het unknown 0.087 phenotype 10/07/2019
49 578609 UTSW Olfr1284 0.127 R7464 G1 225.01 Y 2 111379198 L66Q T A missense Het probably damaging 1.000 phenotype 10/07/2019
50 578627 UTSW Olfr47 0.087 R7464 G1 225.01 Y 6 43236294 S229A T G missense Het probably damaging 0.976 phenotype 10/07/2019
51 578675 UTSW Olfr761 0.106 R7464 G1 225.01 Y 17 37952280 V248D A T missense Het probably damaging 0.996 phenotype 10/07/2019
52 578659 UTSW Oxld1 0.069 R7464 G1 225.01 Y 11 120457137 D78G T C missense Het probably benign 0.001 10/07/2019
53 578669 UTSW Pde1b 0.000 R7464 G1 225.01 Y 15 103524829 I255T T C missense Het probably benign 0.055 0.145 phenotype 10/07/2019
54 578607 UTSW Pkp4 0.000 R7464 G1 225.01 Y 2 59308137 F244I T A missense Het probably benign 0.115 phenotype 10/07/2019
55 578656 UTSW Polg2 1.000 R7464 G1 225.01 Y 11 106773714 V305L C A missense Het probably benign 0.075 phenotype 10/07/2019
56 578598 UTSW Ptpn18 0.107 R7464 G1 225.01 Y 1 34473364 D417N G A missense Het possibly damaging 0.754 0.179 phenotype 10/07/2019
57 578647 UTSW Sash1 1.000 R7464 G1 225.01 Y 10 8756745 D242G T C missense Het possibly damaging 0.816 phenotype 10/07/2019
58 578660 UTSW Six4 0.000 R7464 G1 225.01 Y 12 73112530 T219A T C missense Het possibly damaging 0.888 phenotype 10/07/2019
59 578663 UTSW Slc28a3 0.000 R7464 G1 225.01 Y 13 58563021 Y562* A C nonsense Het probably null 0.975 phenotype 10/07/2019
60 578604 UTSW Soat1 0.134 R7464 G1 225.01 Y 1 156439317 W310R A T missense Het probably damaging 1.000 phenotype 10/07/2019
61 578673 UTSW Son 0.962 R7464 G1 112.46 Y 16 91656691 CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC unclassified Het probably benign phenotype 10/07/2019
62 578667 UTSW Spef2 0.102 R7464 G1 225.01 Y 15 9740585 N30D T C missense Het probably benign 0.234 phenotype 10/07/2019
63 578668 UTSW Srebf2 1.000 R7464 G1 225.01 Y 15 82172874 I270N T A missense Het probably damaging 0.970 0.463 phenotype 10/07/2019
64 578678 UTSW St8sia3 0.133 R7464 G1 225.01 Y 18 64271518 W289R T C missense Het probably damaging 1.000 phenotype 10/07/2019
65 615913 UTSW Stx5a 1.000 R7464 G1 225.01 Y 19 8743504 T A unclassified Het probably benign phenotype 01/13/2020
66 578637 UTSW Tacc1 0.299 R7464 G1 225.01 Y 8 25164464 D689G T C missense Het probably damaging 1.000 0.301 phenotype 10/07/2019
67 578621 UTSW Tacc3 1.000 R7464 G1 225.01 Y 5 33661284 D21G A G missense Het probably benign 0.119 phenotype 10/07/2019
68 578623 UTSW Tapt1 0.862 R7464 G1 225.01 Y 5 44188688 R307* G A nonsense Het probably null phenotype 10/07/2019
69 578653 UTSW Tbc1d9b 0.418 R7464 G1 225.01 Y 11 50131485 V16E T A missense Het probably damaging 0.995 10/07/2019
70 578612 UTSW Tchhl1 0.000 R7464 G1 225.01 Y 3 93470664 R225K G A missense Het probably benign 0.010 phenotype 10/07/2019
71 578628 UTSW Thumpd3 0.374 R7464 G1 225.01 Y 6 113055769 G156D G A missense Het probably benign 0.004 10/07/2019
72 578676 UTSW Tmem178 0.201 R7464 G1 225.01 Y 17 80944902 P72S C T missense Het probably benign 0.000 phenotype 10/07/2019
73 578620 UTSW Tmem52 0.113 R7464 G1 225.01 Y 4 155469469 P46S C T missense Het probably benign 0.331 0.089 10/07/2019
74 578658 UTSW Tmem94 0.193 R7464 G1 225.01 Y 11 115786256 R118L G T missense Het possibly damaging 0.535 0.304 10/07/2019
75 578629 UTSW Tulp3 1.000 R7464 G1 225.01 Y 6 128326829 V269D A T missense Het probably benign 0.001 phenotype 10/07/2019
76 578610 UTSW Ubr1 0.809 R7464 G1 225.01 Y 2 120889774 A G critical splice donor site 2 bp Het probably null phenotype 10/07/2019
77 578641 UTSW Upf1 0.969 R7464 G1 225.01 Y 8 70333423 S962L G A missense Het probably benign 0.000 phenotype 10/07/2019
78 578597 UTSW Vcpip1 0.449 R7464 G1 225.01 Y 1 9746520 R546Q C T missense Het probably damaging 0.994 0.865 phenotype 10/07/2019
79 578630 UTSW Vmn2r49 0.138 R7464 G1 205.01 N 7 9988893 S151R A C missense Het probably benign 0.028 10/07/2019
80 578677 UTSW Wac 1.000 R7464 G1 225.01 Y 18 7871746 T C critical splice donor site 2 bp Het probably null 0.950 phenotype 10/07/2019
81 578638 UTSW Wrn 0.431 R7464 G1 225.01 Y 8 33335996 C T critical splice donor site 1 bp Het probably null 0.959 phenotype 10/07/2019
82 578654 UTSW Zfp286 0.058 R7464 G1 225.01 Y 11 62780801 D149Y C A missense Het probably benign 0.004 10/07/2019
83 578665 UTSW Zfp748 0.100 R7464 G1 225.01 Y 13 67541972 C390R A G missense Het probably damaging 1.000 0.214 10/07/2019
84 578648 UTSW Zfp873 0.095 R7464 G1 225.01 Y 10 82060376 T314A A G missense Het possibly damaging 0.513 0.179 10/07/2019
85 578661 UTSW Zfyve1 0.000 R7464 G1 225.01 Y 12 83551487 D656N C T missense Het probably benign 0.001 0.090 phenotype 10/07/2019
86 578619 UTSW Zmym1 0.139 R7464 G1 225.01 Y 4 127058935 K18* T A nonsense Het probably null 10/07/2019
[records 1 to 86 of 86]