Incidental Mutations

73 incidental mutations are currently displayed, and affect 73 genes.
12 are Possibly Damaging.
22 are Probably Damaging.
28 are Probably Benign.
9 are Probably Null.
3 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 73 of 73] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 579449 UTSW Abcc5 0.000 R7475 G1 225.01 N 16 20399989 N214K G T missense Het probably benign 0.041 phenotype 10/07/2019
2 579452 UTSW Abcf1 0.925 R7475 G1 225.01 N 17 35963567 A G critical splice donor site 2 bp Het probably null phenotype 10/07/2019
3 579445 UTSW Agxt2 0.069 R7475 G1 225.01 N 15 10409537 M508L A T missense Het probably benign 0.000 phenotype 10/07/2019
4 579439 UTSW Akr1c21 0.055 R7475 G1 225.01 N 13 4576319 Y114F A T missense Het probably benign 0.086 10/07/2019
5 579403 UTSW Amz1 0.050 R7475 G1 225.01 N 5 140744186 T C critical splice donor site 2 bp Het probably null 10/07/2019
6 579419 UTSW Ank1 0.464 R7475 G1 225.01 N 8 23132630 A1732S G T missense Het probably benign 0.000 phenotype 10/07/2019
7 579385 UTSW Atg16l1 1.000 R7475 G1 225.01 N 1 87760083 S50P T C missense Het possibly damaging 0.887 phenotype 10/07/2019
8 579425 UTSW AW551984 0.057 R7475 G1 225.01 N 9 39597940 S302P A G missense Het probably damaging 0.998 10/07/2019
9 579386 UTSW Dedd 0.406 R7475 G1 225.01 N 1 171340313 P185Q C A missense Het probably benign 0.372 phenotype 10/07/2019
10 579448 UTSW Fam186a 0.070 R7475 G1 225.01 N 15 99947514 V283E A T missense Het unknown 10/07/2019
11 579436 UTSW Fat2 0.000 R7475 G1 225.01 N 11 55303653 V1187F C A missense Het probably benign 0.306 phenotype 10/07/2019
12 579434 UTSW Fbxw11 0.967 R7475 G1 225.01 N 11 32711999 T C critical splice donor site 2 bp Het probably null phenotype 10/07/2019
13 579411 UTSW Fcgbp 0.000 R7475 G1 225.01 N 7 28102976 T1443I C T missense Het probably damaging 0.987 10/07/2019
14 579408 UTSW Foxj2 0.388 R7475 G1 225.01 N 6 122837842 D279G A G missense Het probably benign 0.143 10/07/2019
15 579398 UTSW Gbp5 0.000 R7475 G1 225.01 N 3 142501361 D97G A G missense Het probably damaging 1.000 0.906 phenotype 10/07/2019
16 579416 UTSW Gm49368 0.231 R7475 G1 225.01 N 7 128107982 T661S A T missense Het possibly damaging 0.595 10/07/2019
17 579423 UTSW Gria4 0.465 R7475 G1 225.01 N 9 4513330 T260P T G missense Het probably damaging 0.999 phenotype 10/07/2019
18 579402 UTSW Gtf2ird2 0.090 R7475 G1 225.01 N 5 134201426 D195E T A missense Het possibly damaging 0.471 10/07/2019
19 579417 UTSW Ikzf5 0.000 R7475 G1 225.01 N 7 131392059 C280S A T missense Het probably benign 0.315 phenotype 10/07/2019
20 579444 UTSW Ints9 1.000 R7475 G1 225.01 N 14 65026465 E395D G T missense Het probably null 0.227 phenotype 10/07/2019
21 579409 UTSW Isoc2b 0.157 R7475 G1 225.01 N 7 4851085 D96G T C missense Het probably benign 0.012 10/07/2019
22 579432 UTSW Jmjd1c 0.632 R7475 G1 225.01 N 10 67225313 S967R T G missense Het probably benign 0.221 phenotype 10/07/2019
23 579389 UTSW Kcnj3 0.000 R7475 G1 225.01 N 2 55437326 K42N A T missense Het probably benign 0.091 phenotype 10/07/2019
24 579395 UTSW Kiz 0.000 R7475 G1 225.01 N 2 146891086 V394A T C missense Het possibly damaging 0.904 phenotype 10/07/2019
25 579392 UTSW Knl1 1.000 R7475 G1 225.01 N 2 119087546 H1795L A T missense Het probably damaging 1.000 phenotype 10/07/2019
26 579418 UTSW Lmntd2 0.058 R7475 G1 225.01 N 7 141210689 A G critical splice donor site 2 bp Het probably null 10/07/2019
27 579457 UTSW Loxhd1 0.148 R7475 G1 225.01 N 18 77412305 D1690E C A missense Het possibly damaging 0.832 phenotype 10/07/2019
28 579388 UTSW Lrp1b 0.000 R7475 G1 225.01 N 2 41344576 D1121G T C missense Het phenotype 10/07/2019
29 579455 UTSW Map3k2 0.000 R7475 G1 225.01 N 18 32199962 V63A T C missense Het possibly damaging 0.608 phenotype 10/07/2019
30 579456 UTSW Mcc 0.000 R7475 G1 225.01 N 18 44476236 A499D G T missense Het probably damaging 0.977 phenotype 10/07/2019
31 579443 UTSW Mcpt9 0.060 R7475 G1 225.01 N 14 56026943 I232F T A missense Het probably damaging 1.000 10/07/2019
32 579450 UTSW Meltf 0.000 R7475 G1 225.01 N 16 31881938 K92R A G missense Het probably benign 0.117 phenotype 10/07/2019
33 579413 UTSW Mrgpra3 0.051 R7475 G1 225.01 N 7 47589947 Y77F T A missense Het probably damaging 1.000 10/07/2019
34 579453 UTSW Ndufv2 1.000 R7475 G1 225.01 N 17 66087537 V111A A G missense Het possibly damaging 0.931 phenotype 10/07/2019
35 579442 UTSW Nkd2 0.000 R7475 G1 225.01 N 13 73825742 E99G T C missense Het probably damaging 0.995 phenotype 10/07/2019
36 579438 UTSW Nlk 1.000 R7475 G1 225.01 N 11 78583399 G358V C A missense Het probably damaging 0.999 phenotype 10/07/2019
37 579428 UTSW Nnmt 0.000 R7475 G1 225.01 N 9 48592232 C165S A T missense Het probably damaging 1.000 phenotype 10/07/2019
38 579427 UTSW Nxpe4 0.076 R7475 G1 225.01 N 9 48393340 C242* T A nonsense Het probably null 10/07/2019
39 579401 UTSW Oas1b 0.050 R7475 G1 178.01 N 5 120817640 N162I A T missense Het probably damaging 0.993 phenotype 10/07/2019
40 579390 UTSW Olfr1191-ps1 0.100 R7475 G1 225.01 N 2 88643210 I148V A G missense Het probably benign 0.000 10/07/2019
41 579412 UTSW Otog 0.756 R7475 G1 225.01 N 7 46267276 N879S A G missense Het probably damaging 0.990 phenotype 10/07/2019
42 579451 UTSW Park2 0.179 R7475 G1 225.01 N 17 11434614 D199G A G missense Het probably benign 0.000 phenotype 10/07/2019
43 579426 UTSW Pcsk7 0.000 R7475 G1 225.01 N 9 45927625 Y612N T A missense Het probably damaging 1.000 phenotype 10/07/2019
44 579405 UTSW Peg10 1.000 R7475 G1 142.47 N 6 4756398 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG small deletion Het probably benign phenotype 10/07/2019
45 579422 UTSW Pgbd5 0.000 R7475 G1 225.01 N 8 124434011 D39G T C missense Het probably benign 0.005 0.077 phenotype 10/07/2019
46 579446 UTSW Pkhd1l1 0.000 R7475 G1 225.01 N 15 44505185 Q800* C T nonsense Het probably null 10/07/2019
47 579387 UTSW Pkn3 0.000 R7475 G1 225.01 N 2 30087110 S621P T C missense Het probably benign 0.010 phenotype 10/07/2019
48 579397 UTSW Polr3c 0.958 R7475 G1 225.01 N 3 96715185 I385V T C missense Het probably benign 0.113 10/07/2019
49 579454 UTSW Ppp1r21 0.216 R7475 G1 225.01 N 17 88555603 G257W G T missense Het probably benign 0.067 10/07/2019
50 579429 UTSW Pxylp1 0.000 R7475 G1 225.01 N 9 96856367 C T critical splice donor site 1 bp Het probably null 10/07/2019
51 579391 UTSW Rasgrp1 0.273 R7475 G1 225.01 N 2 117286108 T613A T C missense Het probably benign 0.000 phenotype 10/07/2019
52 579424 UTSW Robo3 1.000 R7475 G1 225.01 N 9 37425378 V387I C T missense Het probably benign 0.014 phenotype 10/07/2019
53 579404 UTSW Rxfp2 0.000 R7475 G1 225.01 N 5 150049581 Y174N T A missense Het possibly damaging 0.935 phenotype 10/07/2019
54 579435 UTSW Sec24a 0.000 R7475 G1 225.01 N 11 51713552 M746V T C missense Het probably damaging 0.999 phenotype 10/07/2019
55 579407 UTSW Sema4f 0.000 R7475 G1 225.01 N 6 82914374 E571D T A missense Het possibly damaging 0.944 phenotype 10/07/2019
56 579447 UTSW Sept3 0.188 R7475 G1 225.01 N 15 82286456 V217A T C missense Het probably benign 0.001 phenotype 10/07/2019
57 579441 UTSW Serpinb1b 0.057 R7475 G1 225.01 N 13 33093565 K260N A C missense Het probably benign 0.006 10/07/2019
58 579421 UTSW Sin3b 1.000 R7475 G1 225.01 N 8 72749872 T645A A G missense Het possibly damaging 0.466 phenotype 10/07/2019
59 579431 UTSW Sobp 0.674 R7475 G1 225.01 N 10 43021834 R585Q C T missense Het probably damaging 0.975 phenotype 10/07/2019
60 579433 UTSW Specc1l 0.655 R7475 G1 225.01 N 10 75246447 L559Q T A missense Het possibly damaging 0.592 phenotype 10/07/2019
61 579396 UTSW Srxn1 0.096 R7475 G1 101.01 N 2 152105653 C T start gained Het probably benign phenotype 10/07/2019
62 579406 UTSW Sspo 0.000 R7475 G1 225.01 N 6 48455860 R890Q G A missense Het probably benign 0.372 10/07/2019
63 579393 UTSW Stard9 0.195 R7475 G1 225.01 N 2 120688110 D505G A G missense Het probably damaging 0.998 10/07/2019
64 579414 UTSW Tjp1 1.000 R7475 G1 225.01 N 7 65322339 I653K A T missense Het probably damaging 1.000 phenotype 10/07/2019
65 579420 UTSW Tnks 0.000 R7475 G1 225.01 N 8 34831712 E1296K C T missense Het probably damaging 1.000 phenotype 10/07/2019
66 579394 UTSW Ttbk2 1.000 R7475 G1 225.01 N 2 120748640 I667N A T missense Het probably benign 0.012 phenotype 10/07/2019
67 579399 UTSW Usp24 0.000 R7475 G1 225.01 N 4 106342353 S165P T C missense Het possibly damaging 0.546 0.087 phenotype 10/07/2019
68 579400 UTSW Usp46 0.163 R7475 G1 131.01 N 5 74028937 K109* T A nonsense Het probably null phenotype 10/07/2019
69 579440 UTSW Vmn1r191 0.186 R7475 G1 225.01 N 13 22178772 C271R A G missense Het probably benign 0.003 10/07/2019
70 579430 UTSW Wisp3 0.000 R7475 G1 225.01 N 10 39158300 Y102F T A missense Het probably damaging 1.000 phenotype 10/07/2019
71 579415 UTSW Zfp592 0.899 R7475 G1 225.01 N 7 81023452 S55P T C missense Het probably damaging 0.988 phenotype 10/07/2019
72 579437 UTSW Zmynd15 0.250 R7475 G1 225.01 N 11 70461041 S158P T C missense Het probably benign 0.000 phenotype 10/07/2019
73 579410 UTSW Zscan22 0.055 R7475 G1 225.01 N 7 12906737 C303G T G missense Het probably damaging 0.993 10/07/2019
[records 1 to 73 of 73]