Incidental Mutations

69 incidental mutations are currently displayed, and affect 67 genes.
8 are Possibly Damaging.
23 are Probably Damaging.
26 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 69 of 69] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 579783 UTSW 4932414N04Rik 0.000 R7481 G1 225.01 N 2 68664231 F68S T C missense Het unknown 10/07/2019
2 579776 UTSW Abcb6 0.307 R7481 G1 225.01 N 1 75173604 F637L A G missense Het probably damaging 0.999 phenotype 10/07/2019
3 579840 UTSW Aldh3b3 0.167 R7481 G1 225.01 N 19 3964549 M95V A G missense Het probably benign 0.361 10/07/2019
4 579821 UTSW Arhgap45 0.000 R7481 G1 225.01 N 10 80022300 H387L A T missense Het possibly damaging 0.800 10/07/2019
5 579800 UTSW Arntl2 0.241 R7481 G1 225.01 N 6 146818871 A178T G A missense Het not run phenotype 10/07/2019
6 579823 UTSW Avil 0.162 R7481 G1 225.01 N 10 127007591 T130I C T missense Het probably benign 0.327 phenotype 10/07/2019
7 579799 UTSW C1ra 0.000 R7481 G1 225.01 N 6 124517725 E316K G A missense Het probably benign 0.000 0.079 10/07/2019
8 579837 UTSW C3 0.000 R7481 G1 225.01 N 17 57220136 W771L C A missense Het probably damaging 1.000 0.877 phenotype 10/07/2019
9 579831 UTSW C6 0.098 R7481 G1 225.01 N 15 4814875 I926M A G missense Het phenotype 10/07/2019
10 579780 UTSW Cacna1b 0.000 R7481 G1 225.01 N 2 24616862 L1903F G A missense Het probably damaging 0.992 phenotype 10/07/2019
11 579789 UTSW Car3 0.000 R7481 G1 225.01 N 3 14863572 M1L A T start codon destroyed Het probably benign 0.406 phenotype 10/07/2019
12 579828 UTSW Ccdc175 0.070 R7481 G1 225.01 N 12 72155624 I299T A G missense Het probably benign 0.004 10/07/2019
13 579813 UTSW Chd9 0.000 R7481 G1 225.01 N 8 90956438 T502I C T missense Het unknown 10/07/2019
14 579798 UTSW Clec4a1 0.060 R7481 G1 225.01 N 6 122928039 C99Y G A missense Het probably damaging 1.000 10/07/2019
15 579774 UTSW Col19a1 1.000 R7481 G1 225.01 N 1 24317707 G632R C T missense Het probably damaging 1.000 0.929 phenotype 10/07/2019
16 579806 UTSW Dmbt1 0.235 R7481 G1 225.01 N 7 131079511 A T critical splice acceptor site Het probably null phenotype 10/07/2019
17 579817 UTSW Dopey1 0.202 R7481 G1 225.01 N 9 86535932 K1951N A T missense Het probably damaging 0.999 0.143 10/07/2019
18 579829 UTSW Dpf3 0.338 R7481 G1 225.01 N 12 83331927 L122R A C missense Het probably damaging 0.998 phenotype 10/07/2019
19 579805 UTSW E430018J23Rik 0.069 R7481 G1 225.01 N 7 127393324 C38Y C T missense Het probably null 0.876 0.360 10/07/2019
20 579777 UTSW Edem3 0.428 R7481 G1 225.01 N 1 151808222 S687C A T missense Het probably damaging 0.978 phenotype 10/07/2019
21 579778 UTSW Edem3 0.428 R7481 G1 225.01 N 1 151808223 S687N G A missense Het possibly damaging 0.462 phenotype 10/07/2019
22 579820 UTSW Fig4 0.564 R7481 G1 225.01 N 10 41230005 A G critical splice donor site 2 bp Het probably null 0.948 phenotype 10/07/2019
23 579782 UTSW Fmnl2 0.000 R7481 G1 225.01 N 2 53108431 T603A A G missense Het unknown phenotype 10/07/2019
24 579827 UTSW Frmd6 0.000 R7481 G1 225.01 N 12 70887055 L249Q T A missense Het probably damaging 1.000 10/07/2019
25 579807 UTSW Glrx3 1.000 R7481 G1 225.01 N 7 137445022 C48R T C missense Het probably damaging 1.000 phenotype 10/07/2019
26 579809 UTSW Gm40460 R7481 G1 158.46 N 7 142240817 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 10/07/2019
27 579839 UTSW Gm6133 0.774 R7481 G1 225.01 N 18 78349793 M1L A T start codon destroyed Het probably benign 0.126 10/07/2019
28 579830 UTSW Gm9195 0.123 R7481 G1 225.01 N 14 72482676 T105I G A missense Het probably benign 0.073 10/07/2019
29 579797 UTSW Hk2 1.000 R7481 G1 225.01 N 6 82760169 T54I G A missense Het probably benign 0.085 phenotype 10/07/2019
30 579790 UTSW Jade1 0.000 R7481 G1 225.01 N 3 41604690 G402D G A missense Het probably benign 0.000 phenotype 10/07/2019
31 579816 UTSW Kmt2a 1.000 R7481 G1 225.01 N 9 44809071 D3873G T C missense Het unknown phenotype 10/07/2019
32 579804 UTSW Map6 0.125 R7481 G1 225.01 N 7 99269138 T373S A T missense Het possibly damaging 0.574 phenotype 10/07/2019
33 579793 UTSW Megf9 0.150 R7481 G1 225.01 N 4 70433442 T481A T C missense Het probably damaging 0.994 0.136 10/07/2019
34 579811 UTSW Mtus1 0.200 R7481 G1 225.01 N 8 41084615 K21N T A missense Het probably damaging 0.991 phenotype 10/07/2019
35 579808 UTSW Muc5b 0.191 R7481 G1 225.01 N 7 141861171 T2618I C T missense Het unknown 0.087 phenotype 10/07/2019
36 579826 UTSW Nbas 1.000 R7481 G1 225.01 N 12 13356959 I852M A G missense Het probably damaging 0.971 phenotype 10/07/2019
37 579784 UTSW Olfr1167 0.112 R7481 G1 225.01 N 2 88149761 I86T A G missense Het probably benign 0.115 phenotype 10/07/2019
38 579785 UTSW Olfr1242 0.054 R7481 G1 225.01 N 2 89494292 V7I C T missense Het probably benign 0.228 phenotype 10/07/2019
39 579836 UTSW Olfr125 0.089 R7481 G1 225.01 N 17 37835398 M133K T A missense Het probably damaging 1.000 0.558 phenotype 10/07/2019
40 579841 UTSW Olfr1480 0.062 R7481 G1 225.01 N 19 13530453 Q304L A T missense Het probably damaging 0.998 phenotype 10/07/2019
41 579794 UTSW Pank4 0.202 R7481 G1 225.01 N 4 154970038 N156S A G missense Het probably damaging 1.000 phenotype 10/07/2019
42 579838 UTSW Pcdhga8 0.086 R7481 G1 225.01 N 18 37727937 E682G A G missense Het probably benign 0.000 phenotype 10/07/2019
43 579835 UTSW Pde10a 0.000 R7481 G1 225.01 N 17 8949430 D312E C A missense Het possibly damaging 0.602 0.129 phenotype 10/07/2019
44 579833 UTSW Pkhd1l1 0.000 R7481 G1 225.01 N 15 44512911 T990A A G missense Het probably benign 0.000 10/07/2019
45 579810 UTSW Rab11fip1 0.084 R7481 G1 225.01 N 8 27156581 T156A T C missense Het probably damaging 0.998 phenotype 10/07/2019
46 579796 UTSW Rhbdd2 0.101 R7481 G1 225.01 N 5 135636177 S121T T A missense Het possibly damaging 0.872 phenotype 10/07/2019
47 579803 UTSW Rsf1 1.000 R7481 G1 217.47 N 7 97579917 CGGCGGCGG CGGCGGCGGGGGCGGCGG unclassified Het probably benign phenotype 10/07/2019
48 579786 UTSW Ryr3 0.514 R7481 G1 209.01 N 2 112678093 R3418S C A missense Het probably benign 0.160 phenotype 10/07/2019
49 579787 UTSW Ryr3 0.514 R7481 G1 210.01 N 2 112678094 R3418M C A missense Het possibly damaging 0.952 phenotype 10/07/2019
50 579822 UTSW Sbno2 0.347 R7481 G1 225.01 N 10 80057499 P1323S G A missense Het probably benign 0.109 phenotype 10/07/2019
51 579791 UTSW Sec24d 1.000 R7481 G1 225.01 N 3 123350763 C630R T C missense Het probably damaging 1.000 phenotype 10/07/2019
52 579795 UTSW Selplg 0.074 R7481 G1 189.46 N 5 113819695 GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT unclassified Het probably benign phenotype 10/07/2019
53 579832 UTSW Skp2 0.000 R7481 G1 225.01 N 15 9113817 V371E A T missense Het probably damaging 0.971 phenotype 10/07/2019
54 579819 UTSW Soga3 0.199 R7481 G1 225.01 N 10 29196523 V604L G T missense Het probably damaging 1.000 10/07/2019
55 579781 UTSW Strbp 0.384 R7481 G1 225.01 N 2 37600754 S496R A T missense Het probably benign 0.023 phenotype 10/07/2019
56 579824 UTSW Stxbp4 0.000 R7481 G1 225.01 N 11 90594813 T236I G A missense Het possibly damaging 0.938 10/07/2019
57 579814 UTSW Terf2 1.000 R7481 G1 225.01 N 8 107072721 C T critical splice donor site 1 bp Het probably null phenotype 10/07/2019
58 579779 UTSW Thnsl1 0.103 R7481 G1 225.01 N 2 21211788 T118S A T missense Het probably benign 0.001 10/07/2019
59 579802 UTSW Tlnrd1 0.817 R7481 G1 225.01 N 7 83882338 V295E A T missense Het probably damaging 0.999 phenotype 10/07/2019
60 579825 UTSW Ttll6 0.000 R7481 G1 225.01 N 11 96154846 T630A A G missense Het probably benign 0.000 10/07/2019
61 579842 UTSW Usp9y 0.064 R7481 G1 222 N Y 1432180 A435E G T missense Het probably benign 0.077 phenotype 10/07/2019
62 579775 UTSW Vil1 0.260 R7481 G1 225.01 N 1 74419899 R187S A C missense Het probably damaging 0.995 phenotype 10/07/2019
63 579801 UTSW Vmn2r31 0.224 R7481 G1 209.01 N 7 7384580 V664E A T missense Het possibly damaging 0.936 10/07/2019
64 579812 UTSW Wdr17 0.000 R7481 G1 225.01 N 8 54661336 I693M T C missense Het probably benign 0.000 phenotype 10/07/2019
65 579818 UTSW Wdr82 0.938 R7481 G1 225.01 N 9 106176666 T72I C T missense Het probably damaging 0.981 phenotype 10/07/2019
66 579792 UTSW Zbtb5 0.000 R7481 G1 225.01 N 4 44994905 S160P A G missense Het probably benign 0.266 10/07/2019
67 579834 UTSW Zfat 1.000 R7481 G1 225.01 N 15 68178866 Q769* G A nonsense Het probably null phenotype 10/07/2019
68 579788 UTSW Zfp937 0.090 R7481 G1 225.01 N 2 150239346 I432K T A missense Het probably benign 0.012 10/07/2019
69 579815 UTSW Zglp1 0.231 R7481 G1 225.01 N 9 21062607 S261N C T missense Het probably benign 0.000 phenotype 10/07/2019
[records 1 to 69 of 69]