Incidental Mutations

83 incidental mutations are currently displayed, and affect 82 genes.
9 are Possibly Damaging.
24 are Probably Damaging.
31 are Probably Benign.
14 are Probably Null.
5 create premature stop codons.
8 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 83 of 83] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 580194 UTSW Adam21 0.000 R7486 G1 225.01 N 12 81558883 I702V T C missense Het probably benign 0.001 phenotype 10/07/2019
2 580171 UTSW Adgre5 0.000 R7486 G1 225.01 N 8 83723886 E815G T C missense Het probably damaging 0.998 phenotype 10/07/2019
3 580147 UTSW Adgrl2 1.000 R7486 G1 225.01 N 3 148817694 V298A A G missense Het phenotype 10/07/2019
4 580135 UTSW Akp3 0.116 R7486 G1 225.01 N 1 87125479 D91G A G missense Het probably damaging 0.997 phenotype 10/07/2019
5 580170 UTSW Ano8 0.000 R7486 G1 225.01 N 8 71484998 A G critical splice donor site 2 bp Het probably null 10/07/2019
6 580139 UTSW Blvra 0.122 R7486 G1 225.01 N 2 127087323 S136P T C missense Het unknown phenotype 10/07/2019
7 580213 UTSW Cacul1 0.174 R7486 G1 225.01 N 19 60580430 M97L T A missense Het probably benign 0.083 10/07/2019
8 580204 UTSW Ccdc80 0.127 R7486 G1 225.01 N 16 45126179 V827A T C missense Het probably damaging 0.997 phenotype 10/07/2019
9 580185 UTSW Cep68 0.127 R7486 G1 225.01 N 11 20242166 E11G T C missense Het probably benign 0.053 10/07/2019
10 580136 UTSW Cfap221 0.000 R7486 G1 225.01 N 1 119923592 V813E A T missense Het possibly damaging 0.708 10/07/2019
11 580142 UTSW Chd6 0.770 R7486 G1 225.01 N 2 160950003 V2478A A G missense Het probably damaging 0.999 phenotype 10/07/2019
12 580192 UTSW Chmp6 1.000 R7486 G1 225.01 N 11 119916957 F148S T C missense Het probably benign 0.380 phenotype 10/07/2019
13 580146 UTSW Clca3a2 0.163 R7486 G1 225.01 N 3 144797601 I863F T A missense Het probably damaging 1.000 10/07/2019
14 580212 UTSW Cnnm2 1.000 R7486 G1 225.01 N 19 46762074 V101A T C missense Het possibly damaging 0.941 phenotype 10/07/2019
15 580203 UTSW Cpne8 0.114 R7486 G1 225.01 N 15 90515906 A T critical splice donor site 2 bp Het probably null phenotype 10/07/2019
16 580166 UTSW Dmbt1 0.223 R7486 G1 225.01 N 7 131066462 C483G T G missense Het unknown phenotype 10/07/2019
17 580132 UTSW Dnah7b 0.171 R7486 G1 225.01 N 1 46290734 G3246D G A missense Het probably damaging 0.995 10/07/2019
18 580198 UTSW Dnajc3 0.318 R7486 G1 225.01 N 14 118972404 T297K C A missense Het probably benign 0.014 phenotype 10/07/2019
19 580145 UTSW Dpm3 1.000 R7486 G1 225.01 N 3 89266727 A G critical splice acceptor site Het probably null phenotype 10/07/2019
20 580165 UTSW Eef2k 0.147 R7486 G1 225.01 N 7 120858570 N51D A G missense Het probably benign 0.000 phenotype 10/07/2019
21 580159 UTSW Erc1 1.000 R7486 G1 225.01 N 6 119594946 Q1022* G A nonsense Het probably null phenotype 10/07/2019
22 580131 UTSW Ercc5 1.000 R7486 G1 225.01 N 1 44148064 M1K T A start codon destroyed Het probably null 0.995 phenotype 10/07/2019
23 580186 UTSW Fam114a2 0.091 R7486 G1 225.01 N 11 57513689 G83D C T missense Het probably damaging 1.000 10/07/2019
24 580144 UTSW Fat4 1.000 R7486 G1 225.01 N 3 38957427 Y2225* C A nonsense Het probably null phenotype 10/07/2019
25 580180 UTSW Frk 0.184 R7486 G1 225.01 N 10 34547296 W123* G A nonsense Het probably null phenotype 10/07/2019
26 580190 UTSW Gm11568 0.067 R7486 G1 225.01 N 11 99858466 C166S T A missense Het unknown 10/07/2019
27 580149 UTSW Gm12666 0.226 R7486 G1 225.01 N 4 92191269 V105E A T missense Het probably benign 0.107 10/07/2019
28 580154 UTSW Gpr153 0.000 R7486 G1 225.01 N 4 152282401 D337G A G missense Het probably benign 0.007 phenotype 10/07/2019
29 580172 UTSW Gpt2 0.114 R7486 G1 225.01 N 8 85525606 F517L T C missense Het probably damaging 0.976 phenotype 10/07/2019
30 580161 UTSW Gsg1 0.062 R7486 G1 225.01 N 6 135237429 E361K C T missense Het probably benign 0.092 10/07/2019
31 580134 UTSW Hsfy2 0.054 R7486 G1 225.01 N 1 56636971 R136* G A nonsense Het probably null 10/07/2019
32 580141 UTSW Insm1 1.000 R7486 G1 225.01 N 2 146223818 R518H G A missense Het probably damaging 1.000 phenotype 10/07/2019
33 580211 UTSW Kank1 0.000 R7486 G1 225.01 N 19 25410829 C622Y G A missense Het probably damaging 0.988 phenotype 10/07/2019
34 580173 UTSW Katnb1 1.000 R7486 G1 225.01 N 8 95098729 S640R T A missense Het probably damaging 0.997 phenotype 10/07/2019
35 580184 UTSW Kcnmb4 0.000 R7486 G1 225.01 N 10 116418275 V199A A G missense Het probably benign 0.132 phenotype 10/07/2019
36 580193 UTSW Lamb1 1.000 R7486 G1 225.01 N 12 31287442 S391A T G missense Het probably benign 0.001 phenotype 10/07/2019
37 580151 UTSW Macf1 1.000 R7486 G1 225.01 N 4 123409581 D376A T G missense Het probably benign 0.001 phenotype 10/07/2019
38 580152 UTSW Map7d1 0.791 R7486 G1 225.01 N 4 126234386 R614L C A missense Het unknown 10/07/2019
39 580140 UTSW Mcm8 0.734 R7486 G1 225.01 N 2 132839520 R667W C T missense Het probably damaging 1.000 phenotype 10/07/2019
40 580156 UTSW Med13l 0.960 R7486 G1 225.01 N 5 118728474 T531I C T missense Het probably benign 0.170 phenotype 10/07/2019
41 580133 UTSW Mstn 0.343 R7486 G1 225.01 N 1 53063969 A155S G T missense Het probably damaging 0.995 phenotype 10/07/2019
42 580197 UTSW Mycbp2 1.000 R7486 G1 225.01 N 14 103197254 R2251K C T missense Het probably damaging 0.969 phenotype 10/07/2019
43 580189 UTSW Myo19 0.126 R7486 G1 225.01 N 11 84905637 S692P T C missense Het probably benign 0.000 10/07/2019
44 580199 UTSW Nipbl 0.960 R7486 G1 225.01 N 15 8295636 N2514K A T missense Het probably benign 0.254 phenotype 10/07/2019
45 580195 UTSW Nkd2 0.000 R7486 G1 225.01 N 13 73847442 T A splice site Het probably benign phenotype 10/07/2019
46 580205 UTSW Nox3 0.341 R7486 G1 225.01 N 17 3669944 Y322F T A missense Het probably damaging 1.000 phenotype 10/07/2019
47 580179 UTSW Nt5dc1 0.000 R7486 G1 146.01 N 10 34399809 Y135H A G missense Het probably benign 0.264 phenotype 10/07/2019
48 580188 UTSW Olfr389 0.054 R7486 G1 225.01 N 11 73777021 Y102C T C missense Het probably damaging 1.000 phenotype 10/07/2019
49 580167 UTSW Olfr533 0.101 R7486 G1 112.01 N 7 140466034 C T start gained Het probably benign phenotype 10/07/2019
50 580176 UTSW Olfr979 0.101 R7486 G1 225.01 N 9 40000885 Y114F T A missense Het probably benign 0.394 phenotype 10/07/2019
51 580153 UTSW Oog3 0.068 R7486 G1 225.01 N 4 144158172 H398L T A missense Het probably benign 0.163 10/07/2019
52 580183 UTSW Otogl 0.000 R7486 G1 225.01 N 10 107821988 L1027P A G missense Het probably damaging 0.996 phenotype 10/07/2019
53 580196 UTSW Pcdh20 0.000 R7486 G1 225.01 N 14 88468614 I417F T A missense Het possibly damaging 0.785 phenotype 10/07/2019
54 580207 UTSW Pcdha12 0.175 R7486 G1 225.01 N 18 37021557 V443E T A missense Het probably damaging 0.999 phenotype 10/07/2019
55 580208 UTSW Pcdhga2 0.113 R7486 G1 225.01 N 18 37670408 D435G A G missense Het probably benign 0.008 phenotype 10/07/2019
56 580181 UTSW Pcnt 1.000 R7486 G1 225.01 N 10 76418436 T853K G T missense Het probably benign 0.027 phenotype 10/07/2019
57 580182 UTSW Pcnt 1.000 R7486 G1 225.01 N 10 76418437 T853A T C missense Het probably benign 0.000 phenotype 10/07/2019
58 580168 UTSW Pgghg 0.368 R7486 G1 225.01 N 7 140942480 S57R T A missense Het probably benign 0.000 10/07/2019
59 580177 UTSW Ppm1m 0.000 R7486 G1 225.01 N 9 106196611 D301G T C missense Het probably damaging 1.000 10/07/2019
60 580162 UTSW Ppp6r1 0.165 R7486 G1 225.01 N 7 4639900 V519A A G missense Het probably benign 0.166 phenotype 10/07/2019
61 580206 UTSW Prss41 0.065 R7486 G1 148.47 N 17 23844098 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA small deletion Het probably benign 10/07/2019
62 580169 UTSW Rasa3 1.000 R7486 G1 225.01 N 8 13590201 C T critical splice donor site 1 bp Het probably null phenotype 10/07/2019
63 580175 UTSW Robo4 0.280 R7486 G1 223.01 N 9 37405574 V395A T C missense Het probably damaging 0.986 phenotype 10/07/2019
64 580200 UTSW Scrib 1.000 R7486 G1 225.01 N 15 76057650 S1123P A G missense Het probably damaging 1.000 phenotype 10/07/2019
65 580157 UTSW Setd1b 1.000 R7486 G1 225.01 N 5 123163592 K45E A G missense Het probably benign 0.029 phenotype 10/07/2019
66 580209 UTSW Slc14a1 0.000 R7486 G1 225.01 N 18 78111524 S216G T C missense Het probably benign 0.001 phenotype 10/07/2019
67 580210 UTSW Slc25a45 0.100 R7486 G1 225.01 N 19 5884969 Y282C A G missense Het probably damaging 0.959 phenotype 10/07/2019
68 580164 UTSW Slc6a5 1.000 R7486 G1 225.01 N 7 49917330 S255P T C missense Het possibly damaging 0.810 phenotype 10/07/2019
69 580148 UTSW Smc2 0.953 R7486 G1 225.01 N 4 52462861 Q617L A T missense Het possibly damaging 0.542 phenotype 10/07/2019
70 580143 UTSW Spo11 0.000 R7486 G1 225.01 N 2 172984077 D103N G A missense Het probably benign 0.012 phenotype 10/07/2019
71 580201 UTSW Tcf20 0.715 R7486 G1 225.01 N 15 82853734 M1172K A T missense Het possibly damaging 0.777 phenotype 10/07/2019
72 580155 UTSW Tesc 0.490 R7486 G1 225.01 N 5 118046317 S21T T A missense Het probably benign 0.337 phenotype 10/07/2019
73 580150 UTSW Tie1 1.000 R7486 G1 225.01 N 4 118479904 C A critical splice acceptor site Het probably null phenotype 10/07/2019
74 580158 UTSW Trim24 0.000 R7486 G1 225.01 N 6 37957839 T G critical splice donor site 2 bp Het probably null 0.949 phenotype 10/07/2019
75 580138 UTSW Trpm7 1.000 R7486 G1 225.01 N 2 126831195 A G critical splice donor site 2 bp Het probably null phenotype 10/07/2019
76 580191 UTSW Unc13d 0.199 R7486 G1 225.01 N 11 116074433 D193G T C missense Het possibly damaging 0.677 phenotype 10/07/2019
77 580202 UTSW Upk3a 0.087 R7486 G1 225.01 N 15 85018024 A T critical splice acceptor site Het probably null phenotype 10/07/2019
78 580160 UTSW Vmn2r25 0.110 R7486 G1 225.01 N 6 123823142 N747S T C missense Het probably damaging 0.998 10/07/2019
79 580137 UTSW Wipf1 0.161 R7486 G1 111.47 N 2 73440074 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC unclassified Het probably benign phenotype 10/07/2019
80 580178 UTSW Zbtb2 0.888 R7486 G1 225.01 N 10 4369025 Q334* G A nonsense Het probably null 10/07/2019
81 580174 UTSW Zfp653 0.296 R7486 G1 225.01 N 9 22056528 N494D T C missense Het probably damaging 1.000 10/07/2019
82 580163 UTSW Zfp865 0.154 R7486 G1 225.01 N 7 5031260 D748G A G missense Het possibly damaging 0.845 10/07/2019
83 580187 UTSW Zzef1 0.000 R7486 G1 225.01 N 11 72864786 S1014P T C missense Het possibly damaging 0.845 10/07/2019
[records 1 to 83 of 83]