Incidental Mutations

67 incidental mutations are currently displayed, and affect 67 genes.
10 are Possibly Damaging.
27 are Probably Damaging.
17 are Probably Benign.
8 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 67 of 67] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 584552 UTSW Abcc6 0.744 R7553 G1 225.01 Y 7 45999121 L649P A G missense Het probably damaging 0.995 phenotype 10/17/2019
2 584539 UTSW Acad10 0.000 R7553 G1 225.01 Y 5 121639255 Y371C T C missense Het probably damaging 0.999 phenotype 10/17/2019
3 584527 UTSW Avp 1.000 R7553 G1 225.01 Y 2 130581178 V71A A G missense Het probably damaging 0.961 phenotype 10/17/2019
4 584570 UTSW Bhmt 0.000 R7553 G1 225.01 Y 13 93620081 C T critical splice donor site 1 bp Het probably null phenotype 10/17/2019
5 584581 UTSW Capn15 0.316 R7553 G1 225.01 Y 17 25960764 E874G T C missense Het probably damaging 0.957 phenotype 10/17/2019
6 584553 UTSW Capn5 0.082 R7553 G1 225.01 Y 7 98124024 F591S A G missense Het probably damaging 1.000 0.929 phenotype 10/17/2019
7 584534 UTSW Ccne2 0.000 R7553 G1 225.01 Y 4 11201348 Q292L A T missense Het probably benign 0.019 phenotype 10/17/2019
8 584577 UTSW Cd96 0.000 R7553 G1 225.01 Y 16 46052021 T406P T G missense Het probably damaging 0.998 phenotype 10/17/2019
9 584575 UTSW Csnk1e 0.000 R7553 G1 225.01 Y 15 79426366 A153V G A missense Het probably damaging 1.000 0.850 phenotype 10/17/2019
10 584569 UTSW Dlk1 0.780 R7553 G1 225.01 Y 12 109454963 V15I G A missense Het unknown phenotype 10/17/2019
11 584556 UTSW Dmbt1 0.171 R7553 G1 225.01 Y 7 131104867 N1372S A G missense Het unknown 0.087 phenotype 10/17/2019
12 584586 UTSW Dntt 0.000 R7553 G1 225.01 Y 19 41029487 R17W A T missense Het probably damaging 0.990 phenotype 10/17/2019
13 584533 UTSW Erich3 0.000 R7553 G1 225.01 Y 3 154733500 A260S G T missense Het probably benign 0.010 10/17/2019
14 584540 UTSW Foxp2 1.000 R7553 G1 225.01 Y 6 15437882 S669L C T missense Het unknown 0.064 phenotype 10/17/2019
15 584557 UTSW Gm40460 R7553 G1 214.46 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 10/17/2019
16 584550 UTSW Gm9268 0.099 R7553 G1 225.01 N 7 43048023 C835G T G missense Het probably damaging 0.999 10/17/2019
17 584544 UTSW Grid2 0.000 R7553 G1 225.01 Y 6 64076941 K375E A G missense Het possibly damaging 0.955 phenotype 10/17/2019
18 584547 UTSW Grin2b 1.000 R7553 G1 225.01 Y 6 135772396 G603S C T missense Het possibly damaging 0.881 0.346 phenotype 10/17/2019
19 584572 UTSW Hexb 0.000 R7553 G1 225.01 Y 13 97198173 R30Q C T missense Het probably benign 0.015 phenotype 10/17/2019
20 584559 UTSW Homer3 0.124 R7553 G1 225.01 Y 8 70290124 T162S A T missense Het probably benign 0.022 phenotype 10/17/2019
21 584528 UTSW L3mbtl1 0.000 R7553 G1 225.01 Y 2 162948231 E15G A G missense Het probably benign 0.011 phenotype 10/17/2019
22 584535 UTSW Manea 0.099 R7553 G1 225.01 Y 4 26327986 F352I A T missense Het probably damaging 1.000 phenotype 10/17/2019
23 584558 UTSW Mcf2l 0.000 R7553 G1 225.01 Y 8 12997268 M210K T A missense Het probably benign 0.000 phenotype 10/17/2019
24 584579 UTSW Morc3 1.000 R7553 G1 225.01 Y 16 93870936 L734P T C missense Het probably damaging 0.981 phenotype 10/17/2019
25 584551 UTSW Mybpc2 1.000 R7553 G1 225.01 Y 7 44506147 V894A A G missense Het possibly damaging 0.512 phenotype 10/17/2019
26 584566 UTSW Myh4 0.256 R7553 G1 225.01 Y 11 67256395 M1622K T A missense Het probably damaging 0.989 phenotype 10/17/2019
27 584585 UTSW Myrf 0.883 R7553 G1 211.01 Y 19 10228876 F59L A G missense Het probably benign 0.000 phenotype 10/17/2019
28 585994 UTSW Ndst3 0.322 R7553 G1 147.01 Y 3 123557060 G T splice site Het probably null phenotype 10/18/2019
29 584574 UTSW Nln 0.120 R7553 G1 214.46 Y 13 104050416 TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC frame shift Het probably null phenotype 10/17/2019
30 584538 UTSW Nos3 0.000 R7553 G1 225.01 Y 5 24381717 D986V A T missense Het possibly damaging 0.618 phenotype 10/17/2019
31 584561 UTSW Nrp1 1.000 R7553 G1 225.01 Y 8 128431987 A252T G A missense Het probably damaging 1.000 phenotype 10/17/2019
32 584541 UTSW Nup205 0.960 R7553 G1 225.01 Y 6 35201999 R668L G T missense Het probably damaging 0.999 0.910 phenotype 10/17/2019
33 584565 UTSW Olfr313 0.059 R7553 G1 225.01 Y 11 58817060 D17E T A missense Het probably benign 0.105 phenotype 10/17/2019
34 584555 UTSW Olfr477 0.159 R7553 G1 225.01 Y 7 107990475 V37I G A missense Het probably benign 0.027 0.090 phenotype 10/17/2019
35 584554 UTSW Olfr612 0.147 R7553 G1 225.01 Y 7 103539156 Y26C T C missense Het probably damaging 0.987 0.647 phenotype 10/17/2019
36 628217 UTSW Pcdhga1 0.000 R7553 G1 225.01 Y 18 37749682 T A splice site 10139 bp Het probably null phenotype 02/10/2020
37 584529 UTSW Pck1 1.000 R7553 G1 225.01 Y 2 173157067 I373V A G missense Het probably benign 0.134 phenotype 10/17/2019
38 584571 UTSW Pde8b 0.118 R7553 G1 225.01 Y 13 95086750 N227S T C missense Het probably benign 0.210 phenotype 10/17/2019
39 584546 UTSW Pianp 0.101 R7553 G1 225.01 Y 6 124999251 S8A T G missense Het unknown 0.072 phenotype 10/17/2019
40 584560 UTSW Pkd1l3 0.000 R7553 G1 201.46 N 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign 0.085 phenotype 10/17/2019
41 584526 UTSW Pla2r1 0.000 R7553 G1 225.01 Y 2 60522899 N239K A T missense Het possibly damaging 0.795 phenotype 10/17/2019
42 584562 UTSW Pls1 0.133 R7553 G1 225.01 Y 9 95787087 N27I T A missense Het probably damaging 0.999 phenotype 10/17/2019
43 584564 UTSW Prep 1.000 R7553 G1 225.01 Y 10 45158524 *711Q T C makesense Het probably null phenotype 10/17/2019
44 584524 UTSW Prkag3 0.088 R7553 G1 225.01 Y 1 74744735 F330L A G missense Het probably damaging 0.999 0.641 phenotype 10/17/2019
45 584525 UTSW Prss56 0.000 R7553 G1 225.01 Y 1 87183539 D16G A G missense Het probably benign 0.166 phenotype 10/17/2019
46 584573 UTSW Rad17 1.000 R7553 G1 225.01 Y 13 100633286 F255Y A T missense Het probably damaging 0.999 phenotype 10/17/2019
47 584567 UTSW Rap1gap2 0.549 R7553 G1 225.01 Y 11 74435722 E173G T C missense Het probably damaging 0.974 phenotype 10/17/2019
48 584568 UTSW Retreg3 0.000 R7553 G1 225.01 Y 11 101106390 R88H C T missense Het possibly damaging 0.856 10/17/2019
49 584583 UTSW Rhag 0.111 R7553 G1 225.01 Y 17 40828395 G74R G A missense Het probably damaging 1.000 phenotype 10/17/2019
50 584545 UTSW Rybp 1.000 R7553 G1 147.01 N 6 100232259 S201P A G missense Het possibly damaging 0.734 phenotype 10/17/2019
51 584530 UTSW S100a10 0.202 R7553 G1 225.01 Y 3 93564295 C62Y G A missense Het probably benign 0.002 phenotype 10/17/2019
52 584548 UTSW Scgb2b3 0.051 R7553 G1 225.01 Y 7 31360248 S34C T A missense Het possibly damaging 0.842 10/17/2019
53 584576 UTSW Serpind1 0.081 R7553 G1 225.01 Y 16 17336675 D122G A G missense Het probably benign 0.003 phenotype 10/17/2019
54 584531 UTSW Setdb1 1.000 R7553 G1 225.01 Y 3 95346765 L242P A G missense Het probably damaging 1.000 phenotype 10/17/2019
55 584584 UTSW Slc14a2 0.000 R7553 G1 225.01 Y 18 78155588 I776F T A missense Het probably damaging 0.999 phenotype 10/17/2019
56 584537 UTSW Slc9a1 0.000 R7553 G1 225.01 Y 4 133412269 E266G A G missense Het probably damaging 1.000 phenotype 10/17/2019
57 585993 UTSW Stard9 0.194 R7553 G1 225.01 Y 2 120693808 A T splice site 3 bp Het probably null 10/18/2019
58 584532 UTSW Stpg2 0.055 R7553 G1 225.01 Y 3 139218337 Y167C A G missense Het probably damaging 1.000 10/17/2019
59 584563 UTSW Tex264 0.508 R7553 G1 225.01 Y 9 106659136 E274G T C missense Het probably damaging 0.992 10/17/2019
60 584543 UTSW Tigd2 0.092 R7553 G1 225.01 Y 6 59211579 S477N G A missense Het probably benign 0.039 phenotype 10/17/2019
61 584578 UTSW Urb1 1.000 R7553 G1 225.01 Y 16 90792864 L343P A G missense Het probably damaging 1.000 10/17/2019
62 584582 UTSW Vars2 1.000 R7553 G1 225.01 Y 17 35664788 C246S A T missense Het possibly damaging 0.929 phenotype 10/17/2019
63 584523 UTSW Vil1 0.296 R7553 G1 225.01 Y 1 74426732 G A critical splice donor site 1 bp Het probably null phenotype 10/17/2019
64 584549 UTSW Vmn2r61 0.104 R7553 G1 225.01 N 7 42266781 L273V C G missense Het not run 10/17/2019
65 584536 UTSW Zfp37 0.407 R7553 G1 225.01 Y 4 62191999 G317V C A missense Het probably damaging 1.000 phenotype 10/17/2019
66 584580 UTSW Zfp760 0.104 R7553 G1 225.01 Y 17 21722891 K349R A G missense Het possibly damaging 0.817 10/17/2019
67 584542 UTSW Zyx 0.000 R7553 G1 225.01 Y 6 42350474 E69V A T missense Het probably null 0.986 0.086 phenotype 10/17/2019
[records 1 to 67 of 67]