Incidental Mutations

56 incidental mutations are currently displayed, and affect 56 genes.
8 are Possibly Damaging.
20 are Probably Damaging.
18 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 56 of 56] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 586003 UTSW 1700093K21Rik 0.070 R7558 G1 173.01 Y 11 23516285 G T utr 3 prime Het probably null phenotype 10/18/2019
2 584904 UTSW 2410089E03Rik 1.000 R7558 G1 225.01 Y 15 8225367 R13C C T missense Het unknown phenotype 10/17/2019
3 584890 UTSW Adgrg6 1.000 R7558 G1 225.01 Y 10 14431607 M817K A T missense Het probably damaging 0.998 phenotype 10/17/2019
4 584878 UTSW Adh6b 0.118 R7558 G1 225.01 Y 3 138352536 D53E T A missense Het probably benign 0.006 10/17/2019
5 584892 UTSW Ap3d1 0.874 R7558 G1 225.01 Y 10 80722921 V283A A G missense Het possibly damaging 0.915 phenotype 10/17/2019
6 584870 UTSW Arhgap21 0.246 R7558 G1 225.01 Y 2 20855610 Y1329H A G missense Het probably damaging 0.995 phenotype 10/17/2019
7 584888 UTSW B3gnt9 0.124 R7558 G1 225.01 Y 8 105254672 Y28C T C missense Het probably benign 0.226 10/17/2019
8 584894 UTSW Cactin 0.429 R7558 G1 217.47 Y 10 81321318 CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG unclassified Het probably benign 0.090 10/17/2019
9 584907 UTSW Chrd 1.000 R7558 G1 225.01 Y 16 20738554 V641E T A missense Het probably damaging 1.000 phenotype 10/17/2019
10 584891 UTSW Clvs2 0.133 R7558 G1 225.01 Y 10 33543464 I198N A T missense Het probably damaging 0.997 phenotype 10/17/2019
11 584876 UTSW Dbndd2 0.000 R7558 G1 225.01 Y 2 164490216 S120P T C missense Het probably benign 0.003 10/17/2019
12 584911 UTSW Dsg2 0.169 R7558 G1 225.01 Y 18 20594234 V613I G A missense Het probably benign 0.003 0.090 phenotype 10/17/2019
13 584901 UTSW Dsp 1.000 R7558 G1 225.01 Y 13 38168766 M207V A G missense Het probably benign 0.018 phenotype 10/17/2019
14 584906 UTSW Fignl2 0.186 R7558 G1 225.01 Y 15 101054383 E6G T C missense Het probably damaging 1.000 10/17/2019
15 584867 UTSW Fmod 0.407 R7558 G1 225.01 Y 1 134040993 Y257C A G missense Het probably benign 0.419 phenotype 10/17/2019
16 584898 UTSW Foxk2 0.000 R7558 G1 225.01 Y 11 121288058 S239P T C missense Het probably benign 0.004 phenotype 10/17/2019
17 584877 UTSW Fstl5 0.111 R7558 G1 225.01 Y 3 76429785 T217I C T missense Het possibly damaging 0.947 10/17/2019
18 584918 UTSW Gdi1 0.349 R7558 G1 222 Y X 74306855 R55H G A missense Het probably benign 0.001 phenotype 10/17/2019
19 584883 UTSW Gm45140 R7558 G1 145.01 Y 6 87821529 S34F G A missense Het 10/17/2019
20 584910 UTSW H2-Q6 0.503 R7558 G1 201.01 Y 17 35425619 E128G A G missense Het probably benign 0.000 phenotype 10/17/2019
21 584896 UTSW Hmmr 0.000 R7558 G1 225.01 Y 11 40733329 F11L A G missense Het probably damaging 0.995 phenotype 10/17/2019
22 584879 UTSW Igfbpl1 0.061 R7558 G1 225.01 Y 4 45813497 N239K G T missense Het probably damaging 1.000 10/17/2019
23 584885 UTSW Itpr2 0.000 R7558 G1 225.01 Y 6 146390865 D443E G T missense Het probably damaging 1.000 phenotype 10/17/2019
24 584868 UTSW Kcnt2 0.149 R7558 G1 225.01 N 1 140523190 I736F A T missense Het probably damaging 0.979 phenotype 10/17/2019
25 584897 UTSW Kctd11 0.531 R7558 G1 225.01 Y 11 69879590 H207Q A T missense Het probably benign 0.104 10/17/2019
26 584875 UTSW Kif16b 1.000 R7558 G1 225.01 Y 2 142758826 D462E A T missense Het probably damaging 1.000 phenotype 10/17/2019
27 584895 UTSW Kif5a 1.000 R7558 G1 225.01 Y 10 127248079 T81I G A missense Het probably damaging 1.000 phenotype 10/17/2019
28 615894 UTSW Lemd2 1.000 R7558 G1 43.01 Y 17 27204163 A86S C A missense Het probably benign 0.039 phenotype 01/10/2020
29 584872 UTSW Lrp1b 0.000 R7558 G1 225.01 Y 2 41341936 D1174G T C missense Het phenotype 10/17/2019
30 584882 UTSW Lrrc8b 0.152 R7558 G1 225.01 Y 5 105481711 W641L G T missense Het probably damaging 1.000 10/17/2019
31 584912 UTSW Malt1 0.509 R7558 G1 225.01 Y 18 65462834 C438R T C missense Het probably damaging 1.000 phenotype 10/17/2019
32 584884 UTSW March8 0.207 R7558 G1 225.01 Y 6 116403565 F126L T C missense Het possibly damaging 0.891 phenotype 10/17/2019
33 584903 UTSW Nalcn 1.000 R7558 G1 225.01 Y 14 123486385 C A critical splice donor site 1 bp Het probably null phenotype 10/17/2019
34 584866 UTSW Nyap2 0.000 R7558 G1 225.01 Y 1 81269373 T679S A T missense Het probably benign 0.006 phenotype 10/17/2019
35 584915 UTSW Olfr1469 0.124 R7558 G1 225.01 Y 19 13410991 C141S T A missense Het probably damaging 0.996 phenotype 10/17/2019
36 584887 UTSW Olfr503 0.055 R7558 G1 225.01 Y 7 108544721 Y65* C G nonsense Het probably null phenotype 10/17/2019
37 584886 UTSW Otog 0.756 R7558 G1 225.01 Y 7 46303160 P419Q C A missense Het probably damaging 0.990 phenotype 10/17/2019
38 584880 UTSW Pabpc4 0.000 R7558 G1 225.01 Y 4 123294620 S341A T G missense Het possibly damaging 0.943 phenotype 10/17/2019
39 584865 UTSW Pikfyve 1.000 R7558 G1 225.01 Y 1 65272623 H2006Q T A missense Het probably benign 0.006 phenotype 10/17/2019
40 584899 UTSW Ppp2r5e 0.000 R7558 G1 225.01 Y 12 75464992 V319D A T missense Het probably damaging 1.000 phenotype 10/17/2019
41 584902 UTSW Ptk2b 0.624 R7558 G1 225.01 Y 14 66154179 S969G T C missense Het possibly damaging 0.829 phenotype 10/17/2019
42 584869 UTSW Rasal2 0.000 R7558 G1 225.01 Y 1 157175836 R436C G A missense Het probably damaging 0.994 phenotype 10/17/2019
43 584873 UTSW Rpap1 0.965 R7558 G1 225.01 Y 2 119771254 F742I A T missense Het probably benign 0.000 phenotype 10/17/2019
44 584900 UTSW Ryr2 1.000 R7558 G1 225.01 Y 13 11799825 T687M G A missense Het probably damaging 1.000 phenotype 10/17/2019
45 584871 UTSW Sec16a 0.962 R7558 G1 225.01 Y 2 26439734 F7L A T missense Het phenotype 10/17/2019
46 584913 UTSW Slc14a2 0.000 R7558 G1 225.01 Y 18 78192119 I143T A G missense Het probably benign 0.066 phenotype 10/17/2019
47 584914 UTSW Slc22a26 0.049 R7558 G1 225.01 Y 19 7785286 M430L T A missense Het possibly damaging 0.942 10/17/2019
48 584889 UTSW Smarcc1 1.000 R7558 G1 225.01 Y 9 110147116 T157K C A missense Het probably damaging 0.961 phenotype 10/17/2019
49 584874 UTSW Tmem87a 0.165 R7558 G1 225.01 Y 2 120374510 I375T A G missense Het probably benign 0.002 10/17/2019
50 584909 UTSW Tmprss15 0.000 R7558 G1 225.01 Y 16 79003414 I609V T C missense Het possibly damaging 0.553 phenotype 10/17/2019
51 584908 UTSW Tnk2 0.315 R7558 G1 225.01 Y 16 32680085 Q739K C A missense Het probably benign 0.000 phenotype 10/17/2019
52 584905 UTSW Trio 1.000 R7558 G1 225.01 Y 15 27831394 I1340F T A missense Het possibly damaging 0.905 phenotype 10/17/2019
53 584916 UTSW Trpm6 1.000 R7558 G1 225.01 Y 19 18778665 F91L T C missense Het probably damaging 0.957 phenotype 10/17/2019
54 584917 UTSW Vax1 0.885 R7558 G1 225.01 Y 19 59169984 T16A T C missense Het unknown phenotype 10/17/2019
55 584881 UTSW Vps13d 1.000 R7558 G1 225.01 Y 4 145154580 H1481P T G missense Het phenotype 10/17/2019
56 584893 UTSW Zbtb7a 1.000 R7558 G1 210.01 Y 10 81148435 *570W A G makesense Het probably null phenotype 10/17/2019
[records 1 to 56 of 56]