Incidental Mutations

76 incidental mutations are currently displayed, and affect 73 genes.
12 are Possibly Damaging.
29 are Probably Damaging.
28 are Probably Benign.
5 are Probably Null.
4 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 585346 UTSW 4931408C20Rik 0.000 R7565 G1 225.01 N 1 26685270 N276K A T missense Het probably benign 0.005 10/17/2019
2 585411 UTSW 9830107B12Rik R7565 G1 225.01 N 17 48145579 Y63F T A missense Het possibly damaging 0.759 10/17/2019
3 585350 UTSW Abi1 0.772 R7565 G1 225.01 N 2 22946584 I421N A T missense Het probably benign 0.004 phenotype 10/17/2019
4 585417 UTSW Ahnak 0.354 R7565 G1 225.01 N 19 9016156 I4935V A G missense Het probably benign 0.045 phenotype 10/17/2019
5 585414 UTSW Atg12 0.218 R7565 G1 225.01 N 18 46734484 V131G A C missense Het probably damaging 0.995 phenotype 10/17/2019
6 585358 UTSW BC028528 0.091 R7565 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
7 585359 UTSW BC028528 0.091 R7565 G1 217.47 N 3 95888138 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT small insertion Het probably benign 10/17/2019
8 585360 UTSW BC028528 0.091 R7565 G1 217.47 N 3 95888144 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG small insertion Het probably benign 10/17/2019
9 585377 UTSW Bcl3 0.000 R7565 G1 225.01 N 7 19812494 V139I C T missense Het probably damaging 0.997 phenotype 10/17/2019
10 585368 UTSW Bloc1s4 R7565 G1 200.01 N 5 36748345 M101L T A missense Het probably benign 0.086 phenotype 10/17/2019
11 585396 UTSW Bmp6 0.000 R7565 G1 128.01 N 13 38346257 Q109* C T nonsense Het probably null phenotype 10/17/2019
12 585413 UTSW Cabyr 0.075 R7565 G1 225.01 N 18 12744599 T28I C T missense Het possibly damaging 0.503 phenotype 10/17/2019
13 585398 UTSW Catsper3 0.000 R7565 G1 225.01 N 13 55784725 S22P T C missense Het probably benign 0.099 phenotype 10/17/2019
14 585378 UTSW Catsperg2 0.140 R7565 G1 225.01 N 7 29712981 C395S A T missense Het probably null 0.711 10/17/2019
15 585361 UTSW Cd101 0.000 R7565 G1 225.01 N 3 101018792 T208A T C missense Het probably benign 0.002 phenotype 10/17/2019
16 585412 UTSW Chaf1a 1.000 R7565 G1 225.01 N 17 56064148 S678G A G missense Het probably benign 0.003 phenotype 10/17/2019
17 585402 UTSW Chrna2 0.000 R7565 G1 225.01 N 14 66151035 I500L A C missense Het probably benign 0.000 phenotype 10/17/2019
18 585386 UTSW Cln6 0.000 R7565 G1 225.01 N 9 62850757 T266I C T missense Het possibly damaging 0.858 phenotype 10/17/2019
19 585420 UTSW Col17a1 0.000 R7565 G1 110.01 N 19 47671524 T330S T A missense Het possibly damaging 0.768 phenotype 10/17/2019
20 585405 UTSW Cyp2d40 0.123 R7565 G1 225.01 N 15 82760774 V225A A G missense Het unknown 0.090 10/17/2019
21 585372 UTSW Dnah10 0.000 R7565 G1 225.01 N 5 124799031 N2645D A G missense Het probably damaging 0.999 phenotype 10/17/2019
22 585363 UTSW Dph5 0.923 R7565 G1 225.01 N 3 115892797 V74D T A missense Het probably benign 0.000 phenotype 10/17/2019
23 585369 UTSW Dthd1 0.201 R7565 G1 225.01 N 5 62843092 I586L A T missense Het probably damaging 0.998 phenotype 10/17/2019
24 585388 UTSW Elane 0.067 R7565 G1 225.01 N 10 79887045 R95Q G A missense Het probably benign 0.449 phenotype 10/17/2019
25 585397 UTSW Fbxw17 0.000 R7565 G1 225.01 N 13 50433362 T453A A G missense Het probably damaging 0.995 10/17/2019
26 585408 UTSW Fpr3 0.000 R7565 G1 225.01 N 17 17970965 T166K C A missense Het probably damaging 1.000 10/17/2019
27 585370 UTSW Fryl 0.847 R7565 G1 225.01 N 5 73033720 I2724T A G missense Het probably benign 0.180 phenotype 10/17/2019
28 585353 UTSW Fsip2 0.106 R7565 G1 225.01 N 2 82949512 R201C C T missense Het probably damaging 0.969 phenotype 10/17/2019
29 585355 UTSW Gm14496 0.000 R7565 G1 225.01 N 2 181991257 F11Y T A missense Het possibly damaging 0.838 10/17/2019
30 585356 UTSW Gm14496 0.000 R7565 G1 225.01 N 2 182000837 N767S A G missense Het probably damaging 0.989 10/17/2019
31 585373 UTSW Hyal4 0.000 R7565 G1 225.01 N 6 24765934 M429K T A missense Het possibly damaging 0.775 phenotype 10/17/2019
32 585384 UTSW Itgad 0.071 R7565 G1 225.01 N 7 128183015 T208S A T missense Het probably damaging 0.975 phenotype 10/17/2019
33 585409 UTSW Itpr3 0.000 R7565 G1 220.01 N 17 27110888 L1552R T G missense Het probably benign 0.015 phenotype 10/17/2019
34 585374 UTSW Kcp 0.153 R7565 G1 225.01 N 6 29499187 C292Y C T missense Het probably damaging 1.000 phenotype 10/17/2019
35 585371 UTSW Kdr 1.000 R7565 G1 225.01 N 5 75948843 K958R T C missense Het probably damaging 0.974 phenotype 10/17/2019
36 585407 UTSW Klhl22 0.233 R7565 G1 225.01 N 16 17789284 W485R T A missense Het probably damaging 1.000 10/17/2019
37 585376 UTSW Ldhb 0.000 R7565 G1 225.01 N 6 142492519 I271F T A missense Het possibly damaging 0.671 phenotype 10/17/2019
38 585404 UTSW Lmo7 0.149 R7565 G1 225.01 N 14 101885301 R309G A G missense Het probably damaging 0.982 phenotype 10/17/2019
39 585347 UTSW Marco 0.061 R7565 G1 225.01 N 1 120474666 C517F C A missense Het probably damaging 1.000 phenotype 10/17/2019
40 585366 UTSW Mpdz 0.000 R7565 G1 225.01 N 4 81303654 T1423I G A missense Het probably benign 0.009 phenotype 10/17/2019
41 585345 UTSW Ncoa2 0.966 R7565 G1 225.01 N 1 13148376 S1410G T C missense Het probably benign 0.028 phenotype 10/17/2019
42 585392 UTSW Ncor1 1.000 R7565 G1 225.01 N 11 62401265 N283S T C missense Het probably damaging 0.999 phenotype 10/17/2019
43 585382 UTSW Nlrp14 0.188 R7565 G1 225.01 N 7 107181887 L97* T A nonsense Het probably null phenotype 10/17/2019
44 585362 UTSW Olfm3 0.185 R7565 G1 225.01 N 3 115122744 S442A T G missense Het probably damaging 0.984 10/17/2019
45 585410 UTSW Olfr116 0.052 R7565 G1 225.01 N 17 37624501 I45V T C missense Het probably damaging 0.991 phenotype 10/17/2019
46 585419 UTSW Olfr1436 0.062 R7565 G1 225.01 N 19 12298848 T95A T C missense Het probably benign 0.092 phenotype 10/17/2019
47 585381 UTSW Olfr693 0.104 R7565 G1 225.01 N 7 106678126 Y120C T C missense Het probably damaging 1.000 phenotype 10/17/2019
48 585418 UTSW Olfr76 0.283 R7565 G1 225.01 N 19 12120011 S234C T A missense Het probably benign 0.007 phenotype 10/17/2019
49 585391 UTSW Olfr796 0.137 R7565 G1 225.01 N 10 129608160 V107A A G missense Het possibly damaging 0.814 phenotype 10/17/2019
50 585367 UTSW Pank4 0.176 R7565 G1 225.01 N 4 154980550 V769I G A missense Het probably benign 0.075 phenotype 10/17/2019
51 585415 UTSW Pdgfrb 1.000 R7565 G1 225.01 N 18 61083264 D1065N G A missense Het probably damaging 1.000 phenotype 10/17/2019
52 585390 UTSW Ppp1r12a 1.000 R7565 G1 225.01 N 10 108268640 S911N G A missense Het probably benign 0.206 phenotype 10/17/2019
53 585352 UTSW Prdx6b 0.110 R7565 G1 225.01 N 2 80292990 T48A A G missense Het probably damaging 0.986 phenotype 10/17/2019
54 585387 UTSW Pttg1ip 0.000 R7565 G1 225.01 N 10 77597036 K166E A G missense Het probably damaging 1.000 phenotype 10/17/2019
55 585349 UTSW Rabgap1l 0.000 R7565 G1 225.01 N 1 160251417 D9G T C missense Het phenotype 10/17/2019
56 585379 UTSW Rpl13a 0.950 R7565 G1 225.01 N 7 45127042 G69S C T missense Het probably benign 0.046 phenotype 10/17/2019
57 585393 UTSW Rps6ka5 0.000 R7565 G1 225.01 N 12 100616083 I177F T A missense Het probably damaging 0.996 0.699 phenotype 10/17/2019
58 585416 UTSW Rttn 1.000 R7565 G1 225.01 N 18 89060479 A1343E C A missense Het probably damaging 0.995 phenotype 10/17/2019
59 585394 UTSW Ryr2 1.000 R7565 G1 225.01 N 13 11560653 V4820I C T missense Het possibly damaging 0.837 phenotype 10/17/2019
60 585399 UTSW Slc12a7 0.000 R7565 G1 225.01 N 13 73790772 I223V A G missense Het possibly damaging 0.584 phenotype 10/17/2019
61 585400 UTSW Slc9a3 0.000 R7565 G1 225.01 N 13 74157694 V277M G A missense Het probably damaging 1.000 phenotype 10/17/2019
62 585401 UTSW Spata13 0.000 R7565 G1 225.01 N 14 60751849 Y988F A T missense Het probably damaging 0.999 phenotype 10/17/2019
63 585354 UTSW Spo11 0.000 R7565 G1 225.01 N 2 172992071 I329V A G missense Het possibly damaging 0.655 phenotype 10/17/2019
64 585389 UTSW Tcp11l2 0.113 R7565 G1 225.01 N 10 84587134 D63V A T missense Het probably damaging 1.000 10/17/2019
65 585403 UTSW Tdrd3 0.300 R7565 G1 225.01 N 14 87506593 W659* G A nonsense Het probably null phenotype 10/17/2019
66 585375 UTSW Thnsl2 0.128 R7565 G1 225.01 N 6 71141327 D39G T C missense Het probably benign 0.004 phenotype 10/17/2019
67 585383 UTSW Thumpd1 0.176 R7565 G1 225.01 N 7 119716862 L288* A T nonsense Het probably null 10/17/2019
68 585364 UTSW Tram1l1 0.177 R7565 G1 225.01 N 3 124321907 Y239H T C missense Het probably damaging 0.992 10/17/2019
69 585385 UTSW Usp38 0.000 R7565 G1 225.01 N 8 80981972 E992D T A missense Het probably damaging 0.999 10/17/2019
70 585365 UTSW Usp45 0.000 R7565 G1 225.01 N 4 21784790 T159A A G missense Het probably benign 0.005 phenotype 10/17/2019
71 585395 UTSW Vmn1r218 0.298 R7565 G1 225.01 N 13 23136660 T59I C T missense Het probably benign 0.047 10/17/2019
72 585380 UTSW Vmn2r70 0.132 R7565 G1 225.01 N 7 85565291 I218V T C missense Het probably benign 0.349 10/17/2019
73 585348 UTSW Xpr1 0.915 R7565 G1 225.01 N 1 155307742 I461V T C missense Het probably benign 0.000 phenotype 10/17/2019
74 585406 UTSW Ydjc 0.062 R7565 G1 225.01 N 16 17147005 L8P T C missense Het probably damaging 1.000 10/17/2019
75 585351 UTSW Yme1l1 0.964 R7565 G1 205.01 N 2 23160220 N21I A T missense Het possibly damaging 0.880 phenotype 10/17/2019
76 585357 UTSW Zfhx4 0.821 R7565 G1 225.01 N 3 5390366 L1140P T C missense Het probably benign 0.035 10/17/2019
[records 1 to 76 of 76]