Incidental Mutations

46 incidental mutations are currently displayed, and affect 46 genes.
5 are Possibly Damaging.
14 are Probably Damaging.
17 are Probably Benign.
4 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 589514 UTSW 9230112D13Rik 0.158 R7627 G1 225.01 N 14 34512098 I79L T A missense Het unknown 10/24/2019
2 589524 UTSW Acta2 0.179 R7627 G1 225.01 N 19 34252531 T8I G A missense Het probably benign 0.001 0.103 phenotype 10/24/2019
3 589519 UTSW Acvrl1 1.000 R7627 G1 225.01 N 15 101135866 R143Q G A missense Het probably benign 0.084 phenotype 10/24/2019
4 589487 UTSW Adam22 1.000 R7627 G1 225.01 N 5 8367933 S8P A G missense Het probably benign 0.000 phenotype 10/24/2019
5 589500 UTSW Ankrd11 1.000 R7627 G1 225.01 N 8 122890951 I2054T A G missense Het possibly damaging 0.629 phenotype 10/24/2019
6 589505 UTSW Cactin 0.604 R7627 G1 217.47 N 10 81321318 CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG unclassified Het probably benign 0.090 10/24/2019
7 589490 UTSW Cad 0.967 R7627 G1 225.01 N 5 31060164 L354Q T A missense Het probably damaging 0.997 phenotype 10/24/2019
8 589504 UTSW Ccdc15 0.103 R7627 G1 225.01 N 9 37342402 C184S A T missense Het unknown 10/24/2019
9 589507 UTSW Ccl8 0.000 R7627 G1 225.01 N 11 82116039 D26G A G missense Het probably benign 0.130 Ccl12 also affect expression of this gene. [provided by MGI curators] (source: MGI)">phenotype 10/24/2019
10 589501 UTSW Ccsap 0.096 R7627 G1 225.01 N 8 123842358 Y248C T C missense Het probably damaging 1.000 10/24/2019
11 589483 UTSW Col5a1 1.000 R7627 G1 225.01 N 2 27950653 Y271* T G nonsense Het probably null phenotype 10/24/2019
12 589484 UTSW Dnmt3b 1.000 R7627 G1 225.01 N 2 153677580 N695S A G missense Het probably benign 0.025 phenotype 10/24/2019
13 589498 UTSW Dync1li2 0.231 R7627 G1 225.01 N 8 104429508 C234R A G missense Het probably benign 0.298 phenotype 10/24/2019
14 589502 UTSW Dync2h1 1.000 R7627 G1 225.01 N 9 7101111 D2758E A T missense Het probably benign 0.002 phenotype 10/24/2019
15 589494 UTSW Eif2ak3 0.710 R7627 G1 225.01 N 6 70892935 T869S A T missense Het probably benign 0.011 phenotype 10/24/2019
16 589492 UTSW Foxn4 1.000 R7627 G1 225.01 N 5 114260434 P175H G T missense Het possibly damaging 0.870 phenotype 10/24/2019
17 589486 UTSW Gbp5 0.000 R7627 G1 225.01 N 3 142500558 M1R T G start codon destroyed Het probably null 0.999 phenotype 10/24/2019
18 589506 UTSW Glp2r 0.000 R7627 G1 225.01 N 11 67746763 L30I G T missense Het unknown phenotype 10/24/2019
19 589479 UTSW Gls 1.000 R7627 G1 225.01 N 1 52166266 D639E A T missense Het probably benign 0.001 phenotype 10/24/2019
20 589520 UTSW Gm5145 0.913 R7627 G1 225.01 N 17 20570392 E11* G T nonsense Het probably null 10/24/2019
21 589495 UTSW Gm5724 0.060 R7627 G1 225.01 N 6 141744545 V161I C T missense Het probably damaging 0.996 10/24/2019
22 589522 UTSW Gm9772 0.144 R7627 G1 225.01 N 17 22007179 K41N T A missense Het probably damaging 1.000 10/24/2019
23 589488 UTSW Gnat3 0.000 R7627 G1 225.01 N 5 17999748 D133V A T missense Het phenotype 10/24/2019
24 589499 UTSW Gse1 0.168 R7627 G1 225.01 N 8 120572777 P849T C A missense Het unknown 10/24/2019
25 589512 UTSW Hist1h2ak 0.369 R7627 G1 225.01 N 13 21753746 V28L C A missense Het probably benign 0.001 phenotype 10/24/2019
26 589508 UTSW Hoxb9 0.693 R7627 G1 225.01 N 11 96274695 T197A A G missense Het probably damaging 0.991 phenotype 10/24/2019
27 589509 UTSW Krt39 0.071 R7627 G1 225.01 N 11 99514749 S442P A G missense Het possibly damaging 0.799 phenotype 10/24/2019
28 589496 UTSW Leng9 0.074 R7627 G1 225.01 N 7 4148618 L353P A G missense Het probably damaging 1.000 10/24/2019
29 589523 UTSW Mamdc2 0.109 R7627 G1 225.01 N 19 23310991 M561K A T missense Het probably damaging 0.992 10/24/2019
30 589482 UTSW Mamdc4 0.066 R7627 G1 225.01 N 2 25568213 V395A A G missense Het probably damaging 1.000 10/24/2019
31 589511 UTSW Mrpl32 0.822 R7627 G1 225.01 N 13 14612913 R36C G A missense Het probably benign 0.000 phenotype 10/24/2019
32 589480 UTSW Olfr1415 0.084 R7627 G1 225.01 N 1 92491385 Y123* A T nonsense Het probably null phenotype 10/24/2019
33 589503 UTSW Olfr859 0.118 R7627 G1 225.01 N 9 19808651 D111G A G missense Het probably damaging 0.993 phenotype 10/24/2019
34 589485 UTSW Papss1 0.634 R7627 G1 225.01 N 3 131585112 D205E T A missense Het probably benign 0.009 phenotype 10/24/2019
35 589515 UTSW Pdlim2 0.069 R7627 G1 225.01 N 14 70171475 D151G T C missense Het probably benign 0.000 phenotype 10/24/2019
36 589517 UTSW Pdxp R7627 G1 119.01 N 15 78914139 V57A T C missense Het probably damaging 0.999 phenotype 10/24/2019
37 589516 UTSW Plec 0.788 R7627 G1 225.01 N 15 76177394 E2781V T A missense Het probably damaging 1.000 phenotype 10/24/2019
38 589513 UTSW Prr7 0.424 R7627 G1 100.47 N 13 55472334 GCGCCGCCGCACGCGCACCCGCACCCACACCATCACGCACTGCCGCACCCACCGCCGCCGCAC GCGCCGCCGCAC unclassified Het probably benign phenotype 10/24/2019
39 589489 UTSW Rnf32 0.130 R7627 G1 225.01 N 5 29197950 G A start gained Het probably benign phenotype 10/24/2019
40 589510 UTSW Ryr2 1.000 R7627 G1 225.01 N 13 11761327 V1108A A G missense Het possibly damaging 0.647 phenotype 10/24/2019
41 589518 UTSW Slc4a8 0.199 R7627 G1 225.01 N 15 100788223 H276R A G missense Het probably benign 0.075 phenotype 10/24/2019
42 589481 UTSW Spta1 0.884 R7627 G1 225.01 N 1 174205378 D1000E T A missense Het probably damaging 1.000 phenotype 10/24/2019
43 589493 UTSW Sva 0.058 R7627 G1 225.01 N 6 42042664 Q153K C A missense Het unknown 10/24/2019
44 589491 UTSW Tmprss11d 0.070 R7627 G1 225.01 N 5 86309506 Y236C T C missense Het possibly damaging 0.728 phenotype 10/24/2019
45 589521 UTSW Zfp160 0.000 R7627 G1 225.01 N 17 21027008 S607P T C missense Het probably damaging 0.994 10/24/2019
46 589497 UTSW Zfp82 0.154 R7627 G1 225.01 N 7 30056722 G312W C A missense Het probably damaging 1.000 10/24/2019
[records 1 to 46 of 46]