Incidental Mutations

53 incidental mutations are currently displayed, and affect 53 genes.
4 are Possibly Damaging.
20 are Probably Damaging.
16 are Probably Benign.
9 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 590025 UTSW Abca6 0.000 R7637 G1 225.01 Y 11 110218952 Q651L T A missense Het probably benign 0.003 0.085 phenotype 10/24/2019
2 590013 UTSW Adam8 0.000 R7637 G1 225.01 Y 7 139985430 V624I C T missense Het probably damaging 0.983 phenotype 10/24/2019
3 590000 UTSW Ccdc144b 0.052 R7637 G1 225.01 Y 3 36046876 Q49L T A missense Het probably damaging 0.979 10/24/2019
4 590022 UTSW Cltc 0.960 R7637 G1 225.01 Y 11 86730332 H287R T C missense Het probably damaging 0.999 phenotype 10/24/2019
5 590030 UTSW Cmya5 0.319 R7637 G1 225.01 Y 13 93083212 K3243R T C missense Het possibly damaging 0.869 0.093 10/24/2019
6 590031 UTSW Dock5 0.466 R7637 G1 225.01 Y 14 67786340 T1124M G A missense Het possibly damaging 0.955 phenotype 10/24/2019
7 590029 UTSW Fam8a1 0.084 R7637 G1 225.01 Y 13 46671247 M237L A T missense Het probably benign 0.021 0.071 10/24/2019
8 590028 UTSW Fars2 1.000 R7637 G1 225.01 Y 13 36204775 K82N G T missense Het probably benign 0.397 0.090 phenotype 10/24/2019
9 590014 UTSW Gm40460 R7637 G1 101.59 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 10/24/2019
10 590033 UTSW Gm5767 0.107 R7637 G1 225.01 Y 16 8683646 P59L C T missense Het unknown 10/24/2019
11 590006 UTSW Gnat3 0.000 R7637 G1 225.01 Y 5 18003772 D158G A G missense Het 0.274 phenotype 10/24/2019
12 590032 UTSW Grhl2 1.000 R7637 G1 225.01 Y 15 37328330 N400T A C missense Het probably damaging 0.963 phenotype 10/24/2019
13 628289 UTSW Grin2c 0.277 R7637 G1 225.01 Y 11 115256259 A T splice site Het probably null 0.976 phenotype 02/24/2020
14 590011 UTSW Hipk4 0.000 R7637 G1 225.01 Y 7 27523548 Y11C A G missense Het probably damaging 1.000 0.837 phenotype 10/24/2019
15 590036 UTSW Hspa9 0.972 R7637 G1 225.01 N 18 34938687 A620E G T missense Het not run phenotype 10/24/2019
16 590010 UTSW Igkv12-89 0.121 R7637 G1 225.01 Y 6 68835099 S29P A G missense Het probably benign 0.264 10/24/2019
17 589995 UTSW Itga8 0.765 R7637 G1 225.01 Y 2 12109187 D1039E A T missense Het probably damaging 1.000 0.647 phenotype 10/24/2019
18 590020 UTSW Itgae 0.000 R7637 G1 225.01 Y 11 73113631 D248V A T missense Het probably damaging 0.998 0.526 phenotype 10/24/2019
19 590007 UTSW Kmt2c 1.000 R7637 G1 225.01 Y 5 25315095 K2006E T C missense Het probably damaging 0.998 0.062 phenotype 10/24/2019
20 590035 UTSW Mdga1 0.287 R7637 G1 225.01 Y 17 29832379 G934R C T missense Het probably benign 0.003 0.062 phenotype 10/24/2019
21 590003 UTSW Mov10 0.796 R7637 G1 225.01 Y 3 104795885 N896S T C missense Het probably benign 0.264 phenotype 10/24/2019
22 628287 UTSW Ndufb6 0.847 R7637 G1 109.01 Y 4 40273080 A T splice site Het probably null phenotype 02/24/2020
23 628288 UTSW Nlk 1.000 R7637 G1 225.01 Y 11 78591005 T C splice site Het probably null 0.976 phenotype 02/24/2020
24 590002 UTSW Notch2 1.000 R7637 G1 225.01 Y 3 98146623 S2201T T A missense Het probably damaging 0.995 phenotype 10/24/2019
25 589997 UTSW Olfr152 0.191 R7637 G1 225.01 Y 2 87783434 D298V A T missense Het probably damaging 1.000 0.539 phenotype 10/24/2019
26 628291 UTSW Pank1 0.117 R7637 G1 225.01 Y 19 34821988 A C splice site Het probably null phenotype 02/24/2020
27 590015 UTSW Pdlim3 0.654 R7637 G1 225.01 Y 8 45909065 F126S T C missense Het probably damaging 1.000 0.153 phenotype 10/24/2019
28 590008 UTSW Pds5a 1.000 R7637 G1 225.01 Y 5 65638604 G648C C A missense Het probably benign 0.124 phenotype 10/24/2019
29 590024 UTSW Plekhh3 0.114 R7637 G1 188.01 Y 11 101164327 I567V T C missense Het unknown 10/24/2019
30 590019 UTSW Ppfia2 0.000 R7637 G1 225.01 Y 10 106865403 T C critical splice donor site 2 bp Het probably null phenotype 10/24/2019
31 590027 UTSW Prl3d1 0.090 R7637 G1 225.01 Y 13 27100069 D207G A G missense Het probably damaging 0.996 10/24/2019
32 590012 UTSW Prss23 0.063 R7637 G1 225.01 Y 7 89510246 D205V T A missense Het probably benign 0.002 0.090 phenotype 10/24/2019
33 628290 UTSW Pygl 0.578 R7637 G1 225.01 Y 12 70197795 C T splice site Het probably null 0.976 phenotype 02/24/2020
34 589996 UTSW Qsox2 0.067 R7637 G1 225.01 Y 2 26221020 F111S A G missense Het probably damaging 1.000 0.573 phenotype 10/24/2019
35 590009 UTSW Sart3 0.972 R7637 G1 225.01 Y 5 113771352 N95S T C missense Het probably benign 0.142 phenotype 10/24/2019
36 590023 UTSW Scpep1 0.000 R7637 G1 225.01 Y 11 88929220 F414S A G missense Het probably damaging 1.000 phenotype 10/24/2019
37 590001 UTSW Selenbp1 0.000 R7637 G1 225.01 Y 3 94937348 Y105* C A nonsense Het probably null phenotype 10/24/2019
38 589998 UTSW Sirpa 0.000 R7637 G1 225.01 Y 2 129616445 D327G A G missense Het probably benign 0.443 0.140 phenotype 10/24/2019
39 590018 UTSW Sowahc 0.186 R7637 G1 225.01 Y 10 59222183 R47H G A missense Het probably damaging 1.000 0.340 10/24/2019
40 590004 UTSW Szt2 0.538 R7637 G1 225.01 Y 4 118393828 Y361C T C missense Het probably damaging 0.985 phenotype 10/24/2019
41 589994 UTSW Taf3 0.966 R7637 G1 225.01 Y 2 9940993 V600A A G missense Het probably benign 0.004 0.061 phenotype 10/24/2019
42 590005 UTSW Tie1 1.000 R7637 G1 225.01 Y 4 118472978 I1042M T C missense Het probably damaging 1.000 phenotype 10/24/2019
43 590021 UTSW Tmem132e 0.347 R7637 G1 225.01 Y 11 82434516 L114Q T A missense Het probably damaging 1.000 0.225 10/24/2019
44 590037 UTSW Tmx3 0.268 R7637 G1 225.01 Y 18 90537109 T317A A G missense Het probably damaging 0.991 0.100 phenotype 10/24/2019
45 590016 UTSW Tppp3 0.344 R7637 G1 225.01 Y 8 105468292 V69A A G missense Het probably benign 0.022 0.089 10/24/2019
46 589993 UTSW Tpr 1.000 R7637 G1 182.01 Y 1 150423516 Y1156H T C missense Het probably damaging 1.000 0.375 phenotype 10/24/2019
47 590017 UTSW Trank1 0.000 R7637 G1 225.01 Y 9 111365296 D796A A C missense Het possibly damaging 0.710 10/24/2019
48 590034 UTSW Tsc2 1.000 R7637 G1 225.01 Y 17 24607492 P928S G A missense Het probably benign 0.125 0.081 phenotype 10/24/2019
49 589991 UTSW Unc80 0.907 R7637 G1 225.01 Y 1 66672684 V2722F G T missense Het possibly damaging 0.861 0.112 phenotype 10/24/2019
50 590026 UTSW Vmn1r199 0.077 R7637 G1 225.01 Y 13 22382675 L46F G T missense Het probably benign 0.047 10/24/2019
51 590038 UTSW Vps13a 0.000 R7637 G1 225.01 Y 19 16750149 H196Q A T missense Het probably benign 0.018 0.080 phenotype 10/24/2019
52 589992 UTSW Wnt10a 0.000 R7637 G1 225.01 Y 1 74793474 C75* T A nonsense Het probably null 0.975 phenotype 10/24/2019
53 589999 UTSW Zfp335 1.000 R7637 G1 225.01 Y 2 164892539 A G critical splice donor site 2 bp Het probably null phenotype 10/24/2019
[records 1 to 53 of 53]