Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
6 are Possibly Damaging.
17 are Probably Damaging.
28 are Probably Benign.
11 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 590379 UTSW 4930435E12Rik 0.083 R7643 G1 225.01 Y 16 38827863 Y295H A G missense Het probably benign 0.149 0.085 10/24/2019
2 590358 UTSW 4931406C07Rik 0.000 R7643 G1 225.01 Y 9 15297860 F46S A G missense Het probably damaging 1.000 10/24/2019
3 590367 UTSW Acaca 1.000 R7643 G1 225.01 Y 11 84338356 Y1670H T C missense Het probably damaging 1.000 0.541 phenotype 10/24/2019
4 590346 UTSW Acrbp 0.084 R7643 G1 225.01 Y 6 125053832 R272Q G A missense Het possibly damaging 0.921 phenotype 10/24/2019
5 590378 UTSW Adcy6 0.000 R7643 G1 225.01 Y 15 98593568 Q1050L T A missense Het probably benign 0.000 phenotype 10/24/2019
6 590347 UTSW Amn1 0.105 R7643 G1 225.01 Y 6 149185031 M44I C T missense Het probably benign 0.191 0.065 10/24/2019
7 590366 UTSW Ankrd13b 0.493 R7643 G1 225.01 Y 11 77473085 V395A A G missense Het probably benign 0.006 0.080 10/24/2019
8 590349 UTSW Ap3b2 0.112 R7643 G1 225.01 Y 7 81477072 K310R T C missense Het probably benign 0.241 phenotype 10/24/2019
9 590340 UTSW Bnc2 1.000 R7643 G1 225.01 Y 4 84506574 D123G T C missense Het probably benign 0.015 phenotype 10/24/2019
10 590344 UTSW Bst1 0.062 R7643 G1 225.01 Y 5 43840449 M263I G A missense Het probably benign 0.021 0.085 phenotype 10/24/2019
11 590356 UTSW Ccdc7a 0.059 R7643 G1 225.01 Y 8 128889811 G937E C T missense Het probably damaging 0.997 10/24/2019
12 590363 UTSW Cep290 0.942 R7643 G1 225.01 Y 10 100537553 M1232V A G missense Het probably benign 0.000 phenotype 10/24/2019
13 590327 UTSW Cfhr1 0.073 R7643 G1 225.01 Y 1 139553585 Y186H A G missense Het possibly damaging 0.465 phenotype 10/24/2019
14 590323 UTSW Dnah7c 0.388 R7643 G1 225.01 Y 1 46602813 H1203L A T missense Het probably benign 0.000 10/24/2019
15 590331 UTSW Emc7 0.935 R7643 G1 225.01 Y 2 112455279 E71G A G missense Het probably benign 0.010 phenotype 10/24/2019
16 590371 UTSW Exoc3l4 0.072 R7643 G1 117.01 Y 12 111421935 G A intron Het probably benign 10/24/2019
17 590333 UTSW Fam83c 0.067 R7643 G1 225.01 Y 2 155831004 F278L A G missense Het possibly damaging 0.927 10/24/2019
18 590337 UTSW Gabpb2 0.000 R7643 G1 225.01 Y 3 95200225 V180L C A missense Het probably benign 0.088 0.090 phenotype 10/24/2019
19 590338 UTSW Gbp2b 0.000 R7643 G1 225.01 Y 3 142603609 Q160H G T missense Het probably benign 0.068 phenotype 10/24/2019
20 590326 UTSW Gm19965 0.096 R7643 G1 225.01 Y 1 116822229 Q547E C G missense Het unknown 0.087 10/24/2019
21 590353 UTSW Gm40460 R7643 G1 114.53 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 10/24/2019
22 590336 UTSW Gon4l 0.782 R7643 G1 225.01 Y 3 88902807 D1774E T A missense Het probably damaging 0.998 0.128 phenotype 10/24/2019
23 590380 UTSW Gpr15 0.000 R7643 G1 225.01 Y 16 58717816 Y303* A C nonsense Het probably null phenotype 10/24/2019
24 590370 UTSW Greb1 0.000 R7643 G1 225.01 Y 12 16711996 D461G T C missense Het probably damaging 0.994 phenotype 10/24/2019
25 590357 UTSW Gria4 0.506 R7643 G1 225.01 Y 9 4793950 N36S T C missense Het probably benign 0.001 phenotype 10/24/2019
26 590328 UTSW Hacd1 0.171 R7643 G1 225.01 Y 2 14044791 I119V T C missense Het probably damaging 0.998 phenotype 10/24/2019
27 590325 UTSW Ing5 0.348 R7643 G1 225.01 Y 1 93812433 D101E T A missense Het probably damaging 1.000 0.383 phenotype 10/24/2019
28 590377 UTSW Irak4 0.550 R7643 G1 225.01 Y 15 94558828 N297K T A missense Het probably benign 0.051 0.073 phenotype 10/24/2019
29 590364 UTSW Itga7 0.460 R7643 G1 225.01 Y 10 128953501 D971G A G missense Het probably benign 0.126 phenotype 10/24/2019
30 590374 UTSW Klf5 1.000 R7643 G1 225.01 Y 14 99313178 E397G A G missense Het possibly damaging 0.881 0.192 phenotype 10/24/2019
31 590368 UTSW Krtap29-1 0.095 R7643 G1 225.01 Y 11 99978198 G286S C T missense Het probably damaging 0.999 0.194 10/24/2019
32 628225 UTSW Lrp2bp 0.144 R7643 G1 225.01 Y 8 46020527 A T splice site Het probably null 02/11/2020
33 590324 UTSW March4 0.183 R7643 G1 225.01 Y 1 72447220 Q266H T G missense Het probably damaging 1.000 phenotype 10/24/2019
34 590362 UTSW Med23 1.000 R7643 G1 225.01 Y 10 24905965 T1056A A G missense Het probably benign 0.011 phenotype 10/24/2019
35 590361 UTSW Megf11 0.203 R7643 G1 225.01 Y 9 64706632 L1079P T C missense Het probably damaging 1.000 phenotype 10/24/2019
36 590375 UTSW Mycbp2 1.000 R7643 G1 172.01 Y 14 103346265 L85I G T missense Het probably benign 0.000 0.058 phenotype 10/24/2019
37 590365 UTSW Nlgn2 0.000 R7643 G1 225.01 Y 11 69827885 Q290K G T missense Het probably damaging 1.000 0.949 phenotype 10/24/2019
38 590351 UTSW Nox4 0.000 R7643 G1 225.01 Y 7 87323754 E323V A T missense Het probably damaging 1.000 phenotype 10/24/2019
39 590355 UTSW Nup93 0.930 R7643 G1 225.01 Y 8 94286619 T C critical splice donor site 2 bp Het probably null phenotype 10/24/2019
40 590350 UTSW Olfr298 0.078 R7643 G1 225.01 Y 7 86489568 C T critical splice acceptor site Het probably null phenotype 10/24/2019
41 590352 UTSW Olfr558 0.071 R7643 G1 225.01 Y 7 102709538 T93I C T missense Het probably benign 0.001 phenotype 10/24/2019
42 590360 UTSW Olfr977-ps1 R7643 G1 225.01 Y 9 39974821 M1L T A start codon destroyed Het unknown 10/24/2019
43 590369 UTSW Otop3 0.067 R7643 G1 225.01 Y 11 115339648 L117P T C missense Het probably damaging 0.999 0.442 10/24/2019
44 590383 UTSW Pde6c 0.118 R7643 G1 225.01 Y 19 38141421 Q260K C A missense Het probably damaging 0.999 phenotype 10/24/2019
45 590342 UTSW Plb1 0.069 R7643 G1 225.01 Y 5 32247557 Q20* C T nonsense Het probably null 0.966 phenotype 10/24/2019
46 590330 UTSW Qser1 0.498 R7643 G1 225.01 Y 2 104786977 Y1163* A T nonsense Het probably null 0.976 10/24/2019
47 590334 UTSW Rbm12 0.904 R7643 G1 225.01 Y 2 156098217 I45N A T missense Het unknown phenotype 10/24/2019
48 590376 UTSW Rictor 1.000 R7643 G1 225.01 Y 15 6769269 Y332* T A nonsense Het probably null phenotype 10/24/2019
49 590372 UTSW Rpp14 0.952 R7643 G1 225.01 Y 14 8090325 S83* C A nonsense Het probably null 10/24/2019
50 628224 UTSW Sel1l3 0.000 R7643 G1 225.01 Y 5 53123162 C T splice site 5 bp Het probably null 0.976 02/11/2020
51 628226 UTSW Setd2 0.903 R7643 G1 225.01 Y 9 110567840 T C splice site 6 bp Het probably null 0.976 phenotype 02/11/2020
52 590382 UTSW Spink5 1.000 R7643 G1 225.01 Y 18 44010252 T759A A G missense Het probably benign 0.366 phenotype 10/24/2019
53 590343 UTSW Spon2 0.286 R7643 G1 225.01 Y 5 33217456 E2V T A missense Het probably benign 0.001 0.108 phenotype 10/24/2019
54 590384 UTSW Tdrd1 0.390 R7643 G1 225.01 Y 19 56837708 S144P T C missense Het probably damaging 1.000 phenotype 10/24/2019
55 590354 UTSW Tex15 0.311 R7643 G1 225.01 Y 8 33575120 Y1526S A C missense Het probably damaging 0.995 phenotype 10/24/2019
56 590381 UTSW Tnfrsf21 0.140 R7643 G1 225.01 Y 17 43037916 S140P T C missense Het probably benign 0.001 phenotype 10/24/2019
57 590373 UTSW Trav6-2 0.062 R7643 G1 225.01 Y 14 52667442 M11K T A missense Het probably benign 0.166 0.085 10/24/2019
58 628223 UTSW Trp53bp1 0.000 R7643 G1 78.01 Y 2 121247814 G T splice site Het probably null 0.976 phenotype 02/11/2020
59 590329 UTSW Ttn 1.000 R7643 G1 225.01 Y 2 76734827 N28352S T C missense Het possibly damaging 0.653 phenotype 10/24/2019
60 590335 UTSW Uckl1 0.284 R7643 G1 225.01 Y 2 181573106 I292V T C missense Het probably benign 0.077 phenotype 10/24/2019
61 590339 UTSW Unc13b 0.317 R7643 G1 225.01 Y 4 43216333 S211T T A missense Het probably benign 0.000 phenotype 10/24/2019
62 590345 UTSW Zcchc4 0.169 R7643 G1 225.01 Y 5 52808293 I313T T C missense Het possibly damaging 0.852 0.227 10/24/2019
63 590332 UTSW Zfp106 0.000 R7643 G1 225.01 Y 2 120512734 R1811K C T missense Het probably benign 0.011 0.069 phenotype 10/24/2019
64 590359 UTSW Zfp599 0.074 R7643 G1 225.01 Y 9 22249892 Q326K G T missense Het probably benign 0.191 0.090 10/24/2019
65 590348 UTSW Zscan4e 0.119 R7643 G1 225.01 N 7 11309525 M108K A T missense Het probably damaging 0.987 10/24/2019
[records 1 to 65 of 65]