Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
6 are Possibly Damaging.
17 are Probably Damaging.
28 are Probably Benign.
11 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 590379 UTSW 4930435E12Rik 0.072 R7643 G1 225.01 Y 16 38827863 (GRCm38) Y295H A G missense Het probably benign 0.149 0.085 2019-10-24
2 590358 UTSW 4931406C07Rik 0.000 R7643 G1 225.01 Y 9 15297860 (GRCm38) F46S A G missense Het probably damaging 1.000 2019-10-24
3 590367 UTSW Acaca 1.000 R7643 G1 225.01 Y 11 84338356 (GRCm38) Y1670H T C missense Het probably damaging 1.000 0.541 phenotype 2019-10-24
4 590346 UTSW Acrbp 0.080 R7643 G1 225.01 Y 6 125053832 (GRCm38) R272Q G A missense Het possibly damaging 0.921 phenotype 2019-10-24
5 590378 UTSW Adcy6 0.000 R7643 G1 225.01 Y 15 98593568 (GRCm38) Q1050L T A missense Het probably benign 0.000 phenotype 2019-10-24
6 590347 UTSW Amn1 0.104 R7643 G1 225.01 Y 6 149185031 (GRCm38) M44I C T missense Het probably benign 0.191 0.065 2019-10-24
7 590366 UTSW Ankrd13b 0.439 R7643 G1 225.01 Y 11 77473085 (GRCm38) V395A A G missense Het probably benign 0.006 0.080 2019-10-24
8 590349 UTSW Ap3b2 0.097 R7643 G1 225.01 Y 7 81477072 (GRCm38) K310R T C missense Het probably benign 0.241 phenotype 2019-10-24
9 590340 UTSW Bnc2 1.000 R7643 G1 225.01 Y 4 84506574 (GRCm38) D123G T C missense Het probably benign 0.015 phenotype 2019-10-24
10 590344 UTSW Bst1 0.059 R7643 G1 225.01 Y 5 43840449 (GRCm38) M263I G A missense Het probably benign 0.021 0.085 phenotype 2019-10-24
11 590356 UTSW Ccdc7a 0.047 R7643 G1 225.01 Y 8 128889811 (GRCm38) G937E C T missense Het probably damaging 0.997 2019-10-24
12 590363 UTSW Cep290 0.945 R7643 G1 225.01 Y 10 100537553 (GRCm38) M1232V A G missense Het probably benign 0.000 phenotype 2019-10-24
13 590327 UTSW Cfhr1 0.072 R7643 G1 225.01 Y 1 139553585 (GRCm38) Y186H A G missense Het possibly damaging 0.465 phenotype 2019-10-24
14 590323 UTSW Dnah7c 0.249 R7643 G1 225.01 Y 1 46602813 (GRCm38) H1203L A T missense Het probably benign 0.000 2019-10-24
15 590331 UTSW Emc7 0.947 R7643 G1 225.01 Y 2 112455279 (GRCm38) E71G A G missense Het probably benign 0.010 phenotype 2019-10-24
16 590371 UTSW Exoc3l4 0.097 R7643 G1 117.01 Y 12 111421935 (GRCm38) G A intron Het probably benign 2019-10-24
17 590333 UTSW Fam83c 0.066 R7643 G1 225.01 Y 2 155831004 (GRCm38) F278L A G missense Het possibly damaging 0.927 2019-10-24
18 590337 UTSW Gabpb2 0.000 R7643 G1 225.01 Y 3 95200225 (GRCm38) V180L C A missense Het probably benign 0.088 0.090 phenotype 2019-10-24
19 590338 UTSW Gbp2b 0.000 R7643 G1 225.01 Y 3 142603609 (GRCm38) Q160H G T missense Het probably benign 0.068 phenotype 2019-10-24
20 590326 UTSW Gm19965 0.081 R7643 G1 225.01 Y 1 116822229 (GRCm38) Q547E C G missense Het unknown 0.087 2019-10-24
21 590353 UTSW Gm40460 R7643 G1 114.53 N 7 142240713 (GRCm38) ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 2019-10-24
22 590336 UTSW Gon4l 0.807 R7643 G1 225.01 Y 3 88902807 (GRCm38) D1774E T A missense Het probably damaging 0.998 0.128 phenotype 2019-10-24
23 590380 UTSW Gpr15 0.000 R7643 G1 225.01 Y 16 58717816 (GRCm38) Y303* A C nonsense Het probably null phenotype 2019-10-24
24 590370 UTSW Greb1 0.000 R7643 G1 225.01 Y 12 16711996 (GRCm38) D461G T C missense Het probably damaging 0.994 phenotype 2019-10-24
25 590357 UTSW Gria4 0.689 R7643 G1 225.01 Y 9 4793950 (GRCm38) N36S T C missense Het probably benign 0.001 phenotype 2019-10-24
26 590328 UTSW Hacd1 0.295 R7643 G1 225.01 Y 2 14044791 (GRCm38) I119V T C missense Het probably damaging 0.998 0.090 phenotype 2019-10-24
27 590325 UTSW Ing5 0.408 R7643 G1 225.01 Y 1 93812433 (GRCm38) D101E T A missense Het probably damaging 1.000 0.383 phenotype 2019-10-24
28 590377 UTSW Irak4 0.561 R7643 G1 225.01 Y 15 94558828 (GRCm38) N297K T A missense Het probably benign 0.051 0.073 phenotype 2019-10-24
29 590364 UTSW Itga7 0.467 R7643 G1 225.01 Y 10 128953501 (GRCm38) D971G A G missense Het probably benign 0.126 phenotype 2019-10-24
30 590374 UTSW Klf5 1.000 R7643 G1 225.01 Y 14 99313178 (GRCm38) E397G A G missense Het possibly damaging 0.881 0.192 phenotype 2019-10-24
31 590368 UTSW Krtap29-1 0.068 R7643 G1 225.01 Y 11 99978198 (GRCm38) G286S C T missense Het probably damaging 0.999 0.194 2019-10-24
32 628225 UTSW Lrp2bp 0.240 R7643 G1 225.01 Y 8 46020527 (GRCm38) A T splice site Het probably null 2020-02-11
33 590324 UTSW March4 0.111 R7643 G1 225.01 Y 1 72447220 (GRCm38) Q266H T G missense Het probably damaging 1.000 phenotype 2019-10-24
34 590362 UTSW Med23 1.000 R7643 G1 225.01 Y 10 24905965 (GRCm38) T1056A A G missense Het probably benign 0.011 phenotype 2019-10-24
35 590361 UTSW Megf11 0.120 R7643 G1 225.01 Y 9 64706632 (GRCm38) L1079P T C missense Het probably damaging 1.000 phenotype 2019-10-24
36 590375 UTSW Mycbp2 1.000 R7643 G1 172.01 Y 14 103346265 (GRCm38) L85I G T missense Het probably benign 0.000 0.058 phenotype 2019-10-24
37 590365 UTSW Nlgn2 0.000 R7643 G1 225.01 Y 11 69827885 (GRCm38) Q290K G T missense Het probably damaging 1.000 0.949 phenotype 2019-10-24
38 590351 UTSW Nox4 0.000 R7643 G1 225.01 Y 7 87323754 (GRCm38) E323V A T missense Het probably damaging 1.000 phenotype 2019-10-24
39 590355 UTSW Nup93 0.939 R7643 G1 225.01 Y 8 94286619 (GRCm38) T C critical splice donor site 2 bp Het probably null phenotype 2019-10-24
40 590350 UTSW Olfr298 0.123 R7643 G1 225.01 Y 7 86489568 (GRCm38) C T critical splice acceptor site Het probably null phenotype 2019-10-24
41 590352 UTSW Olfr558 0.061 R7643 G1 225.01 Y 7 102709538 (GRCm38) T93I C T missense Het probably benign 0.001 phenotype 2019-10-24
42 590360 UTSW Olfr977-ps1 R7643 G1 225.01 Y 9 39974821 (GRCm38) M1L T A start codon destroyed Het unknown 2019-10-24
43 590369 UTSW Otop3 0.071 R7643 G1 225.01 Y 11 115339648 (GRCm38) L117P T C missense Het probably damaging 0.999 0.442 2019-10-24
44 590383 UTSW Pde6c 0.122 R7643 G1 225.01 Y 19 38141421 (GRCm38) Q260K C A missense Het probably damaging 0.999 phenotype 2019-10-24
45 590342 UTSW Plb1 0.053 R7643 G1 225.01 Y 5 32247557 (GRCm38) Q20* C T nonsense Het probably null 0.966 phenotype 2019-10-24
46 590330 UTSW Qser1 0.460 R7643 G1 225.01 Y 2 104786977 (GRCm38) Y1163* A T nonsense Het probably null 0.976 2019-10-24
47 590334 UTSW Rbm12 0.917 R7643 G1 225.01 Y 2 156098217 (GRCm38) I45N A T missense Het unknown phenotype 2019-10-24
48 590376 UTSW Rictor 1.000 R7643 G1 225.01 Y 15 6769269 (GRCm38) Y332* T A nonsense Het probably null 0.976 phenotype 2019-10-24
49 590372 UTSW Rpp14 0.949 R7643 G1 225.01 Y 14 8090325 (GRCm38) S83* C A nonsense Het probably null 2019-10-24
50 628224 UTSW Sel1l3 0.000 R7643 G1 225.01 Y 5 53123162 (GRCm38) C T splice site 5 bp Het probably null 0.976 2020-02-11
51 628226 UTSW Setd2 0.919 R7643 G1 225.01 Y 9 110567840 (GRCm38) T C splice site 6 bp Het probably null 0.976 phenotype 2020-02-11
52 590382 UTSW Spink5 1.000 R7643 G1 225.01 Y 18 44010252 (GRCm38) T759A A G missense Het probably benign 0.366 phenotype 2019-10-24
53 590343 UTSW Spon2 0.412 R7643 G1 225.01 Y 5 33217456 (GRCm38) E2V T A missense Het probably benign 0.001 0.108 phenotype 2019-10-24
54 590384 UTSW Tdrd1 0.372 R7643 G1 225.01 Y 19 56837708 (GRCm38) S144P T C missense Het probably damaging 1.000 phenotype 2019-10-24
55 590354 UTSW Tex15 0.191 R7643 G1 225.01 Y 8 33575120 (GRCm38) Y1526S A C missense Het probably damaging 0.995 phenotype 2019-10-24
56 590381 UTSW Tnfrsf21 0.191 R7643 G1 225.01 Y 17 43037916 (GRCm38) S140P T C missense Het probably benign 0.001 phenotype 2019-10-24
57 590373 UTSW Trav6-2 0.075 R7643 G1 225.01 Y 14 52667442 (GRCm38) M11K T A missense Het probably benign 0.166 0.085 2019-10-24
58 628223 UTSW Trp53bp1 0.000 R7643 G1 78.01 Y 2 121247814 (GRCm38) G T splice site Het probably null 0.976 phenotype 2020-02-11
59 590329 UTSW Ttn 1.000 R7643 G1 225.01 Y 2 76734827 (GRCm38) N28352S T C missense Het possibly damaging 0.653 phenotype 2019-10-24
60 590335 UTSW Uckl1 0.235 R7643 G1 225.01 Y 2 181573106 (GRCm38) I292V T C missense Het probably benign 0.077 phenotype 2019-10-24
61 590339 UTSW Unc13b 0.230 R7643 G1 225.01 Y 4 43216333 (GRCm38) S211T T A missense Het probably benign 0.000 phenotype 2019-10-24
62 590345 UTSW Zcchc4 0.141 R7643 G1 225.01 Y 5 52808293 (GRCm38) I313T T C missense Het possibly damaging 0.852 0.227 2019-10-24
63 590332 UTSW Zfp106 0.000 R7643 G1 225.01 Y 2 120512734 (GRCm38) R1811K C T missense Het probably benign 0.011 0.069 phenotype 2019-10-24
64 590359 UTSW Zfp599 0.061 R7643 G1 225.01 Y 9 22249892 (GRCm38) Q326K G T missense Het probably benign 0.191 0.090 2019-10-24
65 590348 UTSW Zscan4e 0.083 R7643 G1 225.01 N 7 11309525 (GRCm38) M108K A T missense Het probably damaging 0.987 2019-10-24
[records 1 to 65 of 65]