Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
6 are Possibly Damaging.
16 are Probably Damaging.
20 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 590496 UTSW Actbl2 0.117 R7645 G1 225.01 Y 13 111256255 (GRCm38) C375S T A missense Het probably benign 0.308 2019-10-24
2 628216 UTSW Adgrg3 0.000 R7645 G1 131.01 Y 8 95034764 (GRCm38) A G intron Het probably benign 0.090 phenotype 2020-02-10
3 590478 UTSW Amn1 0.146 R7645 G1 225.01 Y 6 149185031 (GRCm38) M44I C T missense Het probably benign 0.191 0.065 2019-10-24
4 590493 UTSW Atg2b 0.193 R7645 G1 225.01 Y 12 105623430 (GRCm38) Y1854C T C missense Het probably benign 0.060 0.071 phenotype 2019-10-24
5 590479 UTSW Bcat2 0.180 R7645 G1 225.01 Y 7 45587963 (GRCm38) N290K T A missense Het probably benign 0.040 phenotype 2019-10-24
6 628215 UTSW Ccdc39 0.400 R7645 G1 118.01 Y 3 33825169 (GRCm38) T C splice site 222 bp Het probably null phenotype 2020-02-10
7 590486 UTSW Cnot10 1.000 R7645 G1 225.01 Y 9 114613637 (GRCm38) S501G T C missense Het probably benign 0.000 2019-10-24
8 590484 UTSW Col6a6 0.085 R7645 G1 225.01 Y 9 105767198 (GRCm38) A G critical splice donor site 2 bp Het probably null 2019-10-24
9 590476 UTSW Coq2 1.000 R7645 G1 225.01 Y 5 100660250 (GRCm38) C228W A C missense Het probably damaging 0.999 phenotype 2019-10-24
10 590472 UTSW Cpt2 0.164 R7645 G1 225.01 Y 4 107906974 (GRCm38) M531K A T missense Het possibly damaging 0.920 phenotype 2019-10-24
11 590466 UTSW Dennd1a 0.170 R7645 G1 225.01 Y 2 38021363 (GRCm38) L204P A G missense Het probably damaging 1.000 phenotype 2019-10-24
12 590502 UTSW Dirc2 0.901 R7645 G1 225.01 Y 16 35734068 (GRCm38) T A critical splice acceptor site Het probably null phenotype 2019-10-24
13 590498 UTSW Dock9 0.000 R7645 G1 225.01 Y 14 121597663 (GRCm38) V1305M C T missense Het probably benign 0.445 2019-10-24
14 590477 UTSW Dusp16 0.854 R7645 G1 225.01 Y 6 134725925 (GRCm38) I201T A G missense Het probably damaging 0.972 phenotype 2019-10-24
15 590497 UTSW Esco2 1.000 R7645 G1 225.01 Y 14 65827181 (GRCm38) D370G T C missense Het probably benign 0.079 phenotype 2019-10-24
16 590470 UTSW Fbxl4 0.433 R7645 G1 225.01 Y 4 22377037 (GRCm38) S158P T C missense Het probably damaging 0.999 0.468 phenotype 2019-10-24
17 590481 UTSW Fut10 0.110 R7645 G1 225.01 Y 8 31236204 (GRCm38) H329R A G missense Het possibly damaging 0.916 0.345 2019-10-24
18 590492 UTSW Gm10436 0.103 R7645 G1 225.01 N 12 88176258 (GRCm38) T392A T C missense Het probably damaging 1.000 2019-10-24
19 590473 UTSW Gpr3 0.231 R7645 G1 225.01 Y 4 133211329 (GRCm38) W11R A G missense Het probably damaging 0.999 phenotype 2019-10-24
20 590505 UTSW H2-M3 0.000 R7645 G1 225.01 Y 17 37270729 (GRCm38) I94N T A missense Het probably damaging 0.988 phenotype 2019-10-24
21 590501 UTSW Krt7 0.000 R7645 G1 225.01 Y 15 101412643 (GRCm38) I57T T C missense Het probably damaging 0.997 phenotype 2019-10-24
22 590490 UTSW Ltc4s 0.395 R7645 G1 225.01 Y 11 50238546 (GRCm38) T C unclassified Het probably benign phenotype 2019-10-24
23 590510 UTSW Ms4a6b 0.000 R7645 G1 225.01 Y 19 11523940 (GRCm38) T105S A T missense Het probably damaging 0.997 2019-10-24
24 590480 UTSW Muc6 0.113 R7645 G1 225.01 Y 7 141648658 (GRCm38) H592R T C missense Het probably benign 0.396 0.090 phenotype 2019-10-24
25 590483 UTSW Ncam1 0.928 R7645 G1 225.01 Y 9 49565003 (GRCm38) E262G T C missense Het probably benign 0.006 0.126 phenotype 2019-10-24
26 590468 UTSW Olfr1265 0.080 R7645 G1 225.01 Y 2 90037747 (GRCm38) I276K T A missense Het possibly damaging 0.900 phenotype 2019-10-24
27 590511 UTSW Olfr1462 0.071 R7645 G1 225.01 Y 19 13191573 (GRCm38) V302A T C missense Het probably benign 0.014 phenotype 2019-10-24
28 590485 UTSW Plxnb1 0.000 R7645 G1 225.01 Y 9 109114412 (GRCm38) S1908T T A missense Het probably damaging 1.000 phenotype 2019-10-24
29 590491 UTSW Polg2 1.000 R7645 G1 225.01 Y 11 106775593 (GRCm38) M242K A T missense Het probably benign 0.000 phenotype 2019-10-24
30 590495 UTSW Polr3g 1.000 R7645 G1 225.01 Y 13 81694444 (GRCm38) T151A T C missense Het unknown 2019-10-24
31 590504 UTSW Psmb8 0.000 R7645 G1 225.01 Y 17 34200212 (GRCm38) L160P T C missense Het possibly damaging 0.759 phenotype 2019-10-24
32 590489 UTSW Rab5b 0.000 R7645 G1 225.01 Y 10 128681391 (GRCm38) A176V G A missense Het possibly damaging 0.953 0.170 2019-10-24
33 590494 UTSW Rreb1 0.962 R7645 G1 225.01 Y 13 37931034 (GRCm38) C790R T C missense Het probably damaging 1.000 phenotype 2019-10-24
34 590475 UTSW Rufy3 1.000 R7645 G1 225.01 Y 5 88640617 (GRCm38) T506A A G missense Het probably benign 0.012 phenotype 2019-10-24
35 590474 UTSW Samd11 0.127 R7645 G1 225.01 Y 4 156255183 (GRCm38) T C start gained Het probably benign 2019-10-24
36 590509 UTSW Slc12a2 0.000 R7645 G1 225.01 Y 18 57896378 (GRCm38) F279L T C missense Het possibly damaging 0.940 0.179 phenotype 2019-10-24
37 590503 UTSW Son 0.961 R7645 G1 212.47 N 16 91660295 (GRCm38) TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG small deletion Het probably benign phenotype 2019-10-24
38 590488 UTSW Srgn 0.109 R7645 G1 225.01 Y 10 62494978 (GRCm38) W116* C T nonsense Het probably null phenotype 2019-10-24
39 590507 UTSW Svil 0.183 R7645 G1 225.01 Y 18 5099663 (GRCm38) E1733G A G missense Het probably damaging 0.999 0.647 phenotype 2019-10-24
40 590500 UTSW Tbc1d22a 0.000 R7645 G1 225.01 Y 15 86235541 (GRCm38) P49S C T missense Het probably benign 0.010 2019-10-24
41 590482 UTSW Tbc1d9 0.269 R7645 G1 225.01 Y 8 83242553 (GRCm38) K490M A T missense Het probably damaging 1.000 0.207 2019-10-24
42 590506 UTSW Tcte1 0.000 R7645 G1 225.01 Y 17 45534989 (GRCm38) N173S A G missense Het probably benign 0.004 2019-10-24
43 590508 UTSW Tmco6 0.061 R7645 G1 225.01 Y 18 36735393 (GRCm38) R31W C T missense Het probably damaging 1.000 2019-10-24
44 590467 UTSW Ttn 1.000 R7645 G1 225.01 Y 2 76899681 (GRCm38) A5155S C A missense Het unknown 0.087 phenotype 2019-10-24
45 590469 UTSW Tyro3 0.000 R7645 G1 225.01 Y 2 119816906 (GRCm38) Y839H T C missense Het probably damaging 1.000 0.647 phenotype 2019-10-24
46 590487 UTSW Zc3h12d 0.145 R7645 G1 213.01 Y 10 7867576 (GRCm38) D370G A G missense Het probably benign 0.000 0.090 phenotype 2019-10-24
47 590499 UTSW Zc3h7b 0.244 R7645 G1 225.01 Y 15 81780602 (GRCm38) L554P T C missense Het probably damaging 1.000 phenotype 2019-10-24
48 590471 UTSW Zfp352 0.000 R7645 G1 225.01 Y 4 90224777 (GRCm38) P385S C T missense Het probably benign 0.129 0.090 2019-10-24
[records 1 to 48 of 48]