Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
6 are Possibly Damaging.
16 are Probably Damaging.
20 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 590496 UTSW Actbl2 0.124 R7645 G1 225.01 Y 13 111256255 C375S T A missense Het probably benign 0.308 10/24/2019
2 628216 UTSW Adgrg3 0.000 R7645 G1 131.01 Y 8 95034764 A G intron Het probably benign 0.090 phenotype 02/10/2020
3 590478 UTSW Amn1 0.151 R7645 G1 225.01 Y 6 149185031 M44I C T missense Het probably benign 0.191 0.065 10/24/2019
4 590493 UTSW Atg2b 0.224 R7645 G1 225.01 Y 12 105623430 Y1854C T C missense Het probably benign 0.060 0.071 phenotype 10/24/2019
5 590479 UTSW Bcat2 0.159 R7645 G1 225.01 Y 7 45587963 N290K T A missense Het probably benign 0.040 phenotype 10/24/2019
6 628215 UTSW Ccdc39 0.402 R7645 G1 118.01 Y 3 33825169 T C splice site 222 bp Het probably null phenotype 02/10/2020
7 590486 UTSW Cnot10 1.000 R7645 G1 225.01 Y 9 114613637 S501G T C missense Het probably benign 0.000 10/24/2019
8 590484 UTSW Col6a6 0.087 R7645 G1 225.01 Y 9 105767198 A G critical splice donor site 2 bp Het probably null 10/24/2019
9 590476 UTSW Coq2 1.000 R7645 G1 225.01 Y 5 100660250 C228W A C missense Het probably damaging 0.999 phenotype 10/24/2019
10 590472 UTSW Cpt2 0.156 R7645 G1 225.01 Y 4 107906974 M531K A T missense Het possibly damaging 0.920 phenotype 10/24/2019
11 590466 UTSW Dennd1a 0.684 R7645 G1 225.01 Y 2 38021363 L204P A G missense Het probably damaging 1.000 phenotype 10/24/2019
12 590502 UTSW Dirc2 0.868 R7645 G1 225.01 Y 16 35734068 T A critical splice acceptor site Het probably null phenotype 10/24/2019
13 590498 UTSW Dock9 0.000 R7645 G1 225.01 Y 14 121597663 V1305M C T missense Het probably benign 0.445 10/24/2019
14 590477 UTSW Dusp16 0.755 R7645 G1 225.01 Y 6 134725925 I201T A G missense Het probably damaging 0.972 phenotype 10/24/2019
15 590497 UTSW Esco2 1.000 R7645 G1 225.01 Y 14 65827181 D370G T C missense Het probably benign 0.079 phenotype 10/24/2019
16 590470 UTSW Fbxl4 0.279 R7645 G1 225.01 Y 4 22377037 S158P T C missense Het probably damaging 0.999 phenotype 10/24/2019
17 590481 UTSW Fut10 0.108 R7645 G1 225.01 Y 8 31236204 H329R A G missense Het possibly damaging 0.916 0.345 10/24/2019
18 590492 UTSW Gm10436 0.111 R7645 G1 225.01 N 12 88176258 T392A T C missense Het probably damaging 1.000 10/24/2019
19 590473 UTSW Gpr3 0.288 R7645 G1 225.01 Y 4 133211329 W11R A G missense Het probably damaging 0.999 phenotype 10/24/2019
20 590505 UTSW H2-M3 0.000 R7645 G1 225.01 Y 17 37270729 I94N T A missense Het probably damaging 0.988 phenotype 10/24/2019
21 590501 UTSW Krt7 0.000 R7645 G1 225.01 Y 15 101412643 I57T T C missense Het probably damaging 0.997 phenotype 10/24/2019
22 590490 UTSW Ltc4s 0.574 R7645 G1 225.01 Y 11 50238546 T C unclassified Het probably benign phenotype 10/24/2019
23 590510 UTSW Ms4a6b 0.000 R7645 G1 225.01 Y 19 11523940 T105S A T missense Het probably damaging 0.997 10/24/2019
24 590480 UTSW Muc6 0.090 R7645 G1 225.01 Y 7 141648658 H592R T C missense Het probably benign 0.396 0.090 phenotype 10/24/2019
25 590483 UTSW Ncam1 0.905 R7645 G1 225.01 Y 9 49565003 E262G T C missense Het probably benign 0.006 0.126 phenotype 10/24/2019
26 590468 UTSW Olfr1265 0.068 R7645 G1 225.01 Y 2 90037747 I276K T A missense Het possibly damaging 0.900 phenotype 10/24/2019
27 590511 UTSW Olfr1462 0.071 R7645 G1 225.01 Y 19 13191573 V302A T C missense Het probably benign 0.014 phenotype 10/24/2019
28 590485 UTSW Plxnb1 0.000 R7645 G1 225.01 Y 9 109114412 S1908T T A missense Het probably damaging 1.000 phenotype 10/24/2019
29 590491 UTSW Polg2 1.000 R7645 G1 225.01 Y 11 106775593 M242K A T missense Het probably benign 0.000 phenotype 10/24/2019
30 590495 UTSW Polr3g 1.000 R7645 G1 225.01 Y 13 81694444 T151A T C missense Het unknown 10/24/2019
31 590504 UTSW Psmb8 0.000 R7645 G1 225.01 Y 17 34200212 L160P T C missense Het possibly damaging 0.759 phenotype 10/24/2019
32 590489 UTSW Rab5b 0.000 R7645 G1 225.01 Y 10 128681391 A176V G A missense Het possibly damaging 0.953 0.170 10/24/2019
33 590494 UTSW Rreb1 0.960 R7645 G1 225.01 Y 13 37931034 C790R T C missense Het probably damaging 1.000 phenotype 10/24/2019
34 590475 UTSW Rufy3 1.000 R7645 G1 225.01 Y 5 88640617 T506A A G missense Het probably benign 0.012 phenotype 10/24/2019
35 590474 UTSW Samd11 0.122 R7645 G1 225.01 Y 4 156255183 T C start gained Het probably benign 10/24/2019
36 590509 UTSW Slc12a2 0.000 R7645 G1 225.01 Y 18 57896378 F279L T C missense Het possibly damaging 0.940 0.179 phenotype 10/24/2019
37 590503 UTSW Son 0.957 R7645 G1 212.47 N 16 91660295 TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG small deletion Het probably benign phenotype 10/24/2019
38 590488 UTSW Srgn 0.106 R7645 G1 225.01 Y 10 62494978 W116* C T nonsense Het probably null phenotype 10/24/2019
39 590507 UTSW Svil 0.253 R7645 G1 225.01 Y 18 5099663 E1733G A G missense Het probably damaging 0.999 0.647 phenotype 10/24/2019
40 590500 UTSW Tbc1d22a 0.000 R7645 G1 225.01 Y 15 86235541 P49S C T missense Het probably benign 0.010 10/24/2019
41 590482 UTSW Tbc1d9 0.371 R7645 G1 225.01 Y 8 83242553 K490M A T missense Het probably damaging 1.000 0.207 10/24/2019
42 590506 UTSW Tcte1 0.000 R7645 G1 225.01 Y 17 45534989 N173S A G missense Het probably benign 0.004 10/24/2019
43 590508 UTSW Tmco6 0.061 R7645 G1 225.01 Y 18 36735393 R31W C T missense Het probably damaging 1.000 10/24/2019
44 590467 UTSW Ttn 1.000 R7645 G1 225.01 Y 2 76899681 A5155S C A missense Het unknown 0.087 phenotype 10/24/2019
45 590469 UTSW Tyro3 0.000 R7645 G1 225.01 Y 2 119816906 Y839H T C missense Het probably damaging 1.000 0.647 phenotype 10/24/2019
46 590487 UTSW Zc3h12d 0.096 R7645 G1 213.01 Y 10 7867576 D370G A G missense Het probably benign 0.000 0.090 phenotype 10/24/2019
47 590499 UTSW Zc3h7b 0.205 R7645 G1 225.01 Y 15 81780602 L554P T C missense Het probably damaging 1.000 phenotype 10/24/2019
48 590471 UTSW Zfp352 0.000 R7645 G1 225.01 Y 4 90224777 P385S C T missense Het probably benign 0.129 0.090 10/24/2019
[records 1 to 48 of 48]