Incidental Mutations

82 incidental mutations are currently displayed, and affect 81 genes.
14 are Possibly Damaging.
20 are Probably Damaging.
37 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 82 of 82] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 590752 UTSW 2200002J24Rik 0.059 R7650 G1 225.01 Y 7 30699789 V3I G A missense Het probably benign 0.003 10/24/2019
2 590731 UTSW Adam33 0.000 R7650 G1 225.01 Y 2 131061147 E59G T C missense Het probably damaging 0.999 0.213 phenotype 10/24/2019
3 590754 UTSW Akap13 1.000 R7650 G1 225.01 Y 7 75643454 V45E T A missense Het probably benign 0.201 phenotype 10/24/2019
4 590744 UTSW Ap1s1 0.293 R7650 G1 225.01 Y 5 137045533 S28P A G missense Het probably benign 0.000 phenotype 10/24/2019
5 590797 UTSW Btnl2 0.000 R7650 G1 225.01 Y 17 34358129 L86P T C missense Het probably damaging 0.998 10/24/2019
6 590764 UTSW Carm1 1.000 R7650 G1 225.01 Y 9 21580372 V246I G A missense Het probably benign 0.001 phenotype 10/24/2019
7 628357 UTSW Cdk5rap1 0.466 R7650 G1 42.01 Y 2 154354116 D283N C T missense Het probably benign 0.014 phenotype 03/11/2020
8 590804 UTSW Cfap58 0.262 R7650 G1 225.01 Y 19 47986528 N709K C A missense Het possibly damaging 0.839 0.179 10/24/2019
9 590737 UTSW Col24a1 0.000 R7650 G1 225.01 Y 3 145314453 D195G A G missense Het probably benign 0.003 phenotype 10/24/2019
10 590769 UTSW Dcaf1 1.000 R7650 G1 225.01 Y 9 106838344 D220G A G missense Het probably benign 0.009 0.063 phenotype 10/24/2019
11 590757 UTSW Ddias 0.000 R7650 G1 225.01 Y 7 92858935 G591R C T missense Het probably benign 0.001 0.090 10/24/2019
12 590732 UTSW Defb22 0.000 R7650 G1 225.01 Y 2 152486103 I54K A T missense Het probably benign 0.399 0.085 10/24/2019
13 590734 UTSW Dennd4b 0.214 R7650 G1 225.01 Y 3 90268749 W202* G A nonsense Het probably null 0.976 10/24/2019
14 590730 UTSW F2 1.000 R7650 G1 225.01 Y 2 91628396 N523S T C missense Het possibly damaging 0.876 phenotype 10/24/2019
15 590792 UTSW Fam186a 0.069 R7650 G1 225.01 Y 15 99939907 Y2819H A G missense Het unknown 0.087 10/24/2019
16 628359 UTSW Fanca 0.606 R7650 G1 225.01 Y 8 123268564 A T splice site Het probably null phenotype 03/11/2020
17 590785 UTSW Fezf2 0.860 R7650 G1 225.01 Y 14 12342653 H404R T C missense Het probably damaging 0.970 phenotype 10/24/2019
18 590745 UTSW Fry 0.561 R7650 G1 225.01 Y 5 150413418 N1418S A G missense Het probably damaging 1.000 10/24/2019
19 590742 UTSW Gak 1.000 R7650 G1 225.01 Y 5 108584295 S776P A G missense Het probably benign 0.003 phenotype 10/24/2019
20 590803 UTSW Gbf1 1.000 R7650 G1 225.01 Y 19 46272539 H1181R A G missense Het probably damaging 0.999 phenotype 10/24/2019
21 590776 UTSW Gdf9 0.213 R7650 G1 225.01 Y 11 53437098 E294K G A missense Het probably benign 0.062 phenotype 10/24/2019
22 590770 UTSW Gje1 0.142 R7650 G1 225.01 Y 10 14716424 R205* G A nonsense Het probably null phenotype 10/24/2019
23 590775 UTSW Gm12569 0.244 R7650 G1 225.01 Y 11 51234786 E179K G A missense Het possibly damaging 0.944 10/24/2019
24 628360 UTSW Gm8206 R7650 G1 148.13 N 14 6055211 T C splice site Het probably null 03/11/2020
25 628358 UTSW Gpr162 0.090 R7650 G1 79.01 Y 6 124861843 T A start gained Het probably benign phenotype 03/11/2020
26 590790 UTSW Gxylt1 1.000 R7650 G1 225.01 Y 15 93245658 R363H C T missense Het probably benign 0.306 0.090 phenotype 10/24/2019
27 590773 UTSW Hnrnph1 1.000 R7650 G1 225.01 Y 11 50383899 M396L A T missense Het probably benign 0.000 phenotype 10/24/2019
28 590783 UTSW Ice1 0.922 R7650 G1 225.01 Y 13 70589797 V2177A A G missense Het possibly damaging 0.932 10/24/2019
29 590784 UTSW Ice1 0.922 R7650 G1 225.01 Y 13 70605483 Q828L T A missense Het probably damaging 1.000 10/24/2019
30 590728 UTSW Il10 0.783 R7650 G1 225.01 Y 1 131021455 T118S A T missense Het probably benign 0.134 phenotype 10/24/2019
31 590748 UTSW Itpr2 0.000 R7650 G1 225.01 Y 6 146233994 R1813Q C T missense Het probably benign 0.356 0.173 phenotype 10/24/2019
32 590747 UTSW Kbtbd12 0.138 R7650 G1 225.01 Y 6 88618548 Q100L T A missense Het probably damaging 1.000 10/24/2019
33 590729 UTSW Kin 0.957 R7650 G1 225.01 Y 2 10092168 D276G A G missense Het possibly damaging 0.949 phenotype 10/24/2019
34 590788 UTSW Klhl1 0.144 R7650 G1 225.01 Y 14 96346943 T284A T C missense Het probably damaging 0.963 phenotype 10/24/2019
35 590791 UTSW Kmt2d 1.000 R7650 G1 225.01 Y 15 98850870 A2858T C T missense Het unknown phenotype 10/24/2019
36 590793 UTSW Krt8 1.000 R7650 G1 225.01 Y 15 102004163 T26M G A missense Het probably benign 0.074 phenotype 10/24/2019
37 590798 UTSW Lama3 1.000 R7650 G1 225.01 Y 18 12537838 M827K T A missense Het probably benign 0.007 phenotype 10/24/2019
38 590772 UTSW Lingo3 0.069 R7650 G1 225.01 Y 10 80835763 N111S T C missense Het probably damaging 1.000 10/24/2019
39 590800 UTSW Megf10 0.445 R7650 G1 217.47 Y 18 57293999 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA unclassified Het probably benign 0.090 phenotype 10/24/2019
40 590736 UTSW Metap1 0.937 R7650 G1 225.01 Y 3 138466367 V263A A G missense Het probably damaging 0.995 10/24/2019
41 590760 UTSW Muc5ac 0.000 R7650 G1 225.01 N 7 141809422 T2157A A G missense Het unknown phenotype 10/24/2019
42 590779 UTSW Myo1d 0.000 R7650 G1 225.01 Y 11 80601684 H748Q G T missense Het probably benign 0.000 10/24/2019
43 590794 UTSW Nfkbiz 0.702 R7650 G1 225.01 Y 16 55817839 N419K A T missense Het probably benign 0.336 phenotype 10/24/2019
44 590780 UTSW Nol10 0.965 R7650 G1 225.01 Y 12 17362682 T C critical splice donor site 2 bp Het probably null 10/24/2019
45 590781 UTSW Nrcam 0.000 R7650 G1 225.01 Y 12 44547322 L284P T C missense Het probably damaging 1.000 phenotype 10/24/2019
46 590763 UTSW Nrp1 1.000 R7650 G1 225.01 Y 8 128498014 W753R T A missense Het possibly damaging 0.865 phenotype 10/24/2019
47 590777 UTSW Obscn 0.820 R7650 G1 225.01 Y 11 59060994 S3978P A G missense Het probably benign 0.014 phenotype 10/24/2019
48 590795 UTSW Olfr181 0.073 R7650 G1 225.01 Y 16 58926053 R173* T A nonsense Het probably null phenotype 10/24/2019
49 590766 UTSW Olfr968 0.135 R7650 G1 225.01 Y 9 39771873 F309Y A T missense Het probably benign 0.013 phenotype 10/24/2019
50 590751 UTSW Opa3 0.084 R7650 G1 225.01 Y 7 19244971 N120K C A missense Het probably benign 0.004 phenotype 10/24/2019
51 590733 UTSW Pabpc1l 0.000 R7650 G1 225.01 Y 2 164049590 L576S T C missense Het probably benign 0.282 phenotype 10/24/2019
52 590765 UTSW Panx3 0.000 R7650 G1 225.01 Y 9 37661405 L283S A G missense Het probably damaging 0.972 phenotype 10/24/2019
53 590799 UTSW Pcdhb4 0.073 R7650 G1 225.01 Y 18 37309614 V659E T A missense Het probably damaging 0.999 10/24/2019
54 590735 UTSW Pde4dip 1.000 R7650 G1 225.01 Y 3 97699107 A T critical splice donor site 2 bp Het probably null phenotype 10/24/2019
55 590762 UTSW Pkd1l3 0.000 R7650 G1 225.01 Y 8 109672585 V2200A T C missense Het probably benign 0.235 phenotype 10/24/2019
56 590759 UTSW Pkp3 0.116 R7650 G1 225.01 Y 7 141082370 M112I G A missense Het probably benign 0.001 phenotype 10/24/2019
57 590727 UTSW Prex2 0.248 R7650 G1 225.01 Y 1 11149854 I683T T C missense Het possibly damaging 0.665 phenotype 10/24/2019
58 590750 UTSW Psg22 0.055 R7650 G1 225.01 Y 7 18726759 Q438K C A missense Het possibly damaging 0.659 10/24/2019
59 590749 UTSW Ptgir 0.074 R7650 G1 225.01 Y 7 16906951 V56A T C missense Het possibly damaging 0.955 phenotype 10/24/2019
60 590739 UTSW Pus7 0.293 R7650 G1 225.01 Y 5 23760246 T304K G T missense Het probably damaging 0.993 0.922 10/24/2019
61 590756 UTSW Rab38 0.686 R7650 G1 225.01 Y 7 88430429 Y10H T C missense Het possibly damaging 0.948 phenotype 10/24/2019
62 590771 UTSW Ros1 0.151 R7650 G1 225.01 Y 10 52046209 G2277D C T missense Het probably benign 0.001 phenotype 10/24/2019
63 590778 UTSW Rpain 0.929 R7650 G1 225.01 Y 11 70970445 A T unclassified Het probably benign 10/24/2019
64 590740 UTSW Shh 1.000 R7650 G1 125.01 Y 5 28458306 S288I C A missense Het probably benign 0.008 0.090 phenotype 10/24/2019
65 590738 UTSW Slc26a5 0.000 R7650 G1 225.01 Y 5 21834330 V259M C T missense Het possibly damaging 0.956 0.116 phenotype 10/24/2019
66 590786 UTSW Slc4a7 0.896 R7650 G1 225.01 Y 14 14773348 E773K G A missense Het probably benign 0.014 0.077 phenotype 10/24/2019
67 590802 UTSW Slit1 0.000 R7650 G1 225.01 Y 19 41629924 N771I T A missense Het probably damaging 1.000 phenotype 10/24/2019
68 590758 UTSW Stim1 1.000 R7650 G1 225.01 Y 7 102428827 S179T T A missense Het 0.087 phenotype 10/24/2019
69 590782 UTSW Syk 1.000 R7650 G1 225.01 Y 13 52611095 D86G A G missense Het probably benign 0.241 phenotype 10/24/2019
70 590743 UTSW Tmem132b 0.117 R7650 G1 225.01 Y 5 125787010 S727A T G missense Het probably benign 0.043 10/24/2019
71 590768 UTSW Trim42 0.066 R7650 G1 225.01 Y 9 97363148 Y533F T A missense Het probably benign 0.000 0.084 phenotype 10/24/2019
72 590801 UTSW Trpm6 1.000 R7650 G1 225.01 Y 19 18876013 D1799V A T missense Het possibly damaging 0.705 phenotype 10/24/2019
73 590746 UTSW Ttc26 0.660 R7650 G1 225.01 Y 6 38395040 N188K T A missense Het probably benign 0.220 0.288 phenotype 10/24/2019
74 590767 UTSW Ube4a 0.000 R7650 G1 225.01 Y 9 44933436 I839N A T missense Het probably damaging 0.989 phenotype 10/24/2019
75 590741 UTSW Ugt2b36 0.133 R7650 G1 225.01 Y 5 87080972 I404T A G missense Het probably damaging 0.996 10/24/2019
76 590761 UTSW Ushbp1 0.000 R7650 G1 225.01 Y 8 71390924 Q290L T A missense Het possibly damaging 0.773 10/24/2019
77 590787 UTSW Vcl 1.000 R7650 G1 225.01 Y 14 20995046 I273K T A missense Het probably damaging 1.000 phenotype 10/24/2019
78 590755 UTSW Vmn2r73 0.249 R7650 G1 225.01 Y 7 85871939 I274L T A missense Het probably benign 0.000 10/24/2019
79 590789 UTSW Zc3h7b 0.205 R7650 G1 225.01 Y 15 81793650 D945G A G missense Het possibly damaging 0.808 0.211 phenotype 10/24/2019
80 590774 UTSW Zfp454 0.062 R7650 G1 225.01 Y 11 50883753 L31P A G missense Het probably damaging 0.979 10/24/2019
81 590753 UTSW Zfp536 1.000 R7650 G1 225.01 Y 7 37569692 V100L C A missense Het probably damaging 0.998 phenotype 10/24/2019
82 590796 UTSW Zfp942 0.078 R7650 G1 225.01 Y 17 21928837 S270R A T missense Het probably benign 0.072 10/24/2019
[records 1 to 82 of 82]