Incidental Mutations

61 incidental mutations are currently displayed, and affect 61 genes.
8 are Possibly Damaging.
24 are Probably Damaging.
19 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 61 of 61] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 592356 UTSW 5330417C22Rik 0.078 R7674 G1 225.01 Y 3 108462991 R698S T G missense Het probably damaging 0.999 phenotype 11/12/2019
2 592388 UTSW Abca6 0.000 R7674 G1 225.01 Y 11 110219297 I607F T A missense Het probably damaging 0.999 phenotype 11/12/2019
3 592399 UTSW Abcc4 0.000 R7674 G1 225.01 Y 14 118611487 D559E A T missense Het probably damaging 1.000 phenotype 11/12/2019
4 592352 UTSW Abl1 0.942 R7674 G1 225.01 Y 2 31689829 V8A T C missense Het possibly damaging 0.911 phenotype 11/12/2019
5 592346 UTSW Alkal1 0.118 R7674 G1 225.01 Y 1 6389488 Y96F A T missense Het probably damaging 0.999 11/12/2019
6 592385 UTSW Asb3 0.282 R7674 G1 225.01 Y 11 31081435 C352S T A missense Het possibly damaging 0.917 0.213 11/12/2019
7 592367 UTSW B4galnt3 0.065 R7674 G1 225.01 Y 6 120215205 D523E G T missense Het probably benign 0.011 phenotype 11/12/2019
8 592395 UTSW Cadps 1.000 R7674 G1 225.01 Y 14 12411581 E1258D C A missense Het probably damaging 0.994 phenotype 11/12/2019
9 592380 UTSW Carmil2 0.096 R7674 G1 225.01 Y 8 105697286 Q1257L A T missense Het possibly damaging 0.929 phenotype 11/12/2019
10 592373 UTSW Cars 1.000 R7674 G1 225.01 Y 7 143587103 A G critical splice donor site 2 bp Het probably null phenotype 11/12/2019
11 592390 UTSW Ccdc88c 0.000 R7674 G1 225.01 Y 12 100945232 A781E G T missense Het probably benign 0.002 phenotype 11/12/2019
12 592387 UTSW Ccr10 0.000 R7674 G1 225.01 Y 11 101174649 D18E A T missense Het probably benign 0.000 phenotype 11/12/2019
13 628293 UTSW Cdcp1 0.000 R7674 G1 66.01 Y 9 123216006 C A start gained Het probably benign phenotype 02/24/2020
14 592378 UTSW Ces5a 0.126 R7674 G1 225.01 Y 8 93514269 R400L C A missense Het probably damaging 0.995 phenotype 11/12/2019
15 592359 UTSW Clcn6 0.145 R7674 G1 225.01 Y 4 148012694 V636M C T missense Het probably damaging 1.000 phenotype 11/12/2019
16 592386 UTSW Cluh 0.258 R7674 G1 225.01 Y 11 74667720 L1206H T A missense Het probably damaging 1.000 0.647 phenotype 11/12/2019
17 592382 UTSW Cog2 1.000 R7674 G1 225.01 Y 8 124537882 N333K C A missense Het probably damaging 0.961 0.647 phenotype 11/12/2019
18 592351 UTSW Dnah14 0.099 R7674 G1 225.01 Y 1 181707533 I2355L A T missense Het probably benign 0.011 phenotype 11/12/2019
19 592379 UTSW Dok4 0.324 R7674 G1 225.01 Y 8 94866562 Y165C T C missense Het probably damaging 0.997 11/12/2019
20 592369 UTSW Dpy19l3 0.152 R7674 G1 225.01 Y 7 35695309 D601E A C missense Het probably damaging 0.998 11/12/2019
21 592398 UTSW Egr3 0.658 R7674 G1 173.01 Y 14 70078077 G A critical splice donor site 1 bp Het probably null phenotype 11/12/2019
22 592389 UTSW Evpl 0.000 R7674 G1 225.01 Y 11 116222568 K1432R T C missense Het probably benign 0.403 phenotype 11/12/2019
23 592364 UTSW Fbxw8 0.723 R7674 G1 225.01 Y 5 118124971 C214* A T nonsense Het probably null phenotype 11/12/2019
24 592358 UTSW Gm13088 0.053 R7674 G1 225.01 Y 4 143655605 K174* T A nonsense Het probably null 11/12/2019
25 592375 UTSW Gm45861 0.082 R7674 G1 225.01 Y 8 27540119 Y821S A C missense Het unknown 0.198 11/12/2019
26 592403 UTSW Gm5519 0.387 R7674 G1 225.01 N 19 33825028 G157A G C missense Het probably benign 0.080 11/12/2019
27 592370 UTSW Gys1 1.000 R7674 G1 225.01 Y 7 45455071 S641P T C missense Het probably damaging 0.978 0.275 phenotype 11/12/2019
28 592391 UTSW Ighv6-6 0.089 R7674 G1 225.01 Y 12 114435217 I10L T A missense Het probably benign 0.000 11/12/2019
29 592357 UTSW Ikbkap 1.000 R7674 G1 225.01 Y 4 56792075 Q231R T C missense Het probably damaging 0.972 phenotype 11/12/2019
30 592394 UTSW Jmy 0.168 R7674 G1 225.01 Y 13 93442599 R675Q C T missense Het probably damaging 1.000 11/12/2019
31 592349 UTSW Kif14 0.931 R7674 G1 225.01 Y 1 136468820 T288I C T missense Het probably damaging 0.988 phenotype 11/12/2019
32 592397 UTSW Kpna3 0.671 R7674 G1 225.01 Y 14 61367637 N520K A T missense Het probably benign 0.000 phenotype 11/12/2019
33 592377 UTSW Lonp2 0.222 R7674 G1 225.01 Y 8 86665758 Q484L A T missense Het probably benign 0.020 0.436 phenotype 11/12/2019
34 592353 UTSW Lrp1b 0.000 R7674 G1 225.01 Y 2 42652909 T A start gained Het probably benign phenotype 11/12/2019
35 592402 UTSW Mpeg1 0.074 R7674 G1 225.01 Y 19 12461387 M70L A T missense Het probably benign 0.000 11/12/2019
36 592393 UTSW Msh3 0.283 R7674 G1 225.01 Y 13 92212503 V1074L C A missense Het probably benign 0.083 phenotype 11/12/2019
37 592372 UTSW Muc6 0.084 R7674 G1 225.01 Y 7 141639825 L1645Q A T missense Het unknown phenotype 11/12/2019
38 592400 UTSW Nipbl 0.967 R7674 G1 225.01 Y 15 8293101 V2609I C T missense Het probably benign 0.148 phenotype 11/12/2019
39 592348 UTSW Nucks1 0.542 R7674 G1 225.01 Y 1 131931106 T202N C A missense Het probably benign 0.335 phenotype 11/12/2019
40 592354 UTSW Olfr1024 0.091 R7674 G1 225.01 Y 2 85904536 F173V A C missense Het probably damaging 1.000 phenotype 11/12/2019
41 592401 UTSW Olfr119 0.050 R7674 G1 225.01 Y 17 37700682 N4S A G missense Het probably benign 0.032 phenotype 11/12/2019
42 592355 UTSW Olfr1262 0.063 R7674 G1 225.01 Y 2 90003045 Y213F A T missense Het probably damaging 0.992 phenotype 11/12/2019
43 592396 UTSW Olfr1509 0.497 R7674 G1 225.01 Y 14 52450442 T10A A G missense Het probably benign 0.001 phenotype 11/12/2019
44 592383 UTSW Olfr870 0.057 R7674 G1 225.01 Y 9 20171253 L106P A G missense Het possibly damaging 0.952 phenotype 11/12/2019
45 592374 UTSW Plekha2 0.000 R7674 G1 225.01 Y 8 25057298 S257P A G missense Het probably damaging 1.000 0.339 phenotype 11/12/2019
46 592404 UTSW Pnlip 0.160 R7674 G1 225.01 Y 19 58675154 G187A G C missense Het possibly damaging 0.697 phenotype 11/12/2019
47 592392 UTSW Rasgrf2 0.178 R7674 G1 225.01 Y 13 92131406 S30N C T missense Het possibly damaging 0.649 phenotype 11/12/2019
48 592366 UTSW Rho 0.118 R7674 G1 225.01 Y 6 115932333 C110F G T missense Het probably damaging 1.000 phenotype 11/12/2019
49 592363 UTSW Selplg 0.071 R7674 G1 150.46 N 5 113819695 GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT unclassified Het probably benign phenotype 11/12/2019
50 592384 UTSW Slc2a12 0.000 R7674 G1 225.01 Y 10 22693994 D528G A G missense Het probably damaging 0.983 0.150 phenotype 11/12/2019
51 592360 UTSW Sorcs2 0.000 R7674 G1 166.01 Y 5 36397952 R32C G A missense Het probably damaging 0.986 0.165 phenotype 11/12/2019
52 592347 UTSW Sp110 0.430 R7674 G1 176.01 N 1 85579092 R417C G A missense Het 11/12/2019
53 592362 UTSW Srp72 0.943 R7674 G1 225.01 Y 5 76974826 N35Y A T missense Het probably damaging 0.982 phenotype 11/12/2019
54 628292 UTSW Tm2d2 1.000 R7674 G1 111.01 Y 8 25018264 Y141* C A nonsense Het probably null 0.976 phenotype 02/24/2020
55 592350 UTSW Tor3a 0.088 R7674 G1 225.01 Y 1 156655908 H315Y G A missense Het possibly damaging 0.773 11/12/2019
56 592371 UTSW Usp17la 0.086 R7674 G1 225.01 Y 7 104861447 K420* A T nonsense Het probably null 11/12/2019
57 592368 UTSW Vmn2r26 0.075 R7674 G1 225.01 Y 6 124039362 W262R T C missense Het probably benign 0.000 phenotype 11/12/2019
58 592361 UTSW Yipf7 0.000 R7674 G1 225.01 Y 5 69519229 V189D A T missense Het probably damaging 0.993 11/12/2019
59 592365 UTSW Zan 0.066 R7674 G1 225.01 Y 5 137467108 M462L T A missense Het possibly damaging 0.737 phenotype 11/12/2019
60 592381 UTSW Zc3h18 0.950 R7674 G1 217.47 Y 8 122383556 AGG AG frame shift Het probably null 0.976 11/12/2019
61 592376 UTSW Zfp930 0.000 R7674 G1 216.01 Y 8 69228685 H344L A T missense Het probably damaging 1.000 0.647 11/12/2019
[records 1 to 61 of 61]