Incidental Mutations

53 incidental mutations are currently displayed, and affect 53 genes.
9 are Possibly Damaging.
18 are Probably Damaging.
17 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 594308 UTSW 1600014C23Rik 0.399 R7706 G1 225.01 Y 17 45733657 T46I G A missense Het unknown 11/12/2019
2 594279 UTSW Arhgef1 0.389 R7706 G1 225.01 Y 7 24916881 D317N G A missense Het probably damaging 1.000 0.067 phenotype 11/12/2019
3 594267 UTSW Atxn7l2 0.250 R7706 G1 225.01 Y 3 108207403 D109G T C missense Het probably damaging 0.979 11/12/2019
4 594276 UTSW B4galnt3 0.078 R7706 G1 225.01 Y 6 120218952 V305L C A missense Het probably benign 0.161 phenotype 11/12/2019
5 594297 UTSW C9 0.000 R7706 G1 225.01 Y 15 6458921 N85K T A missense Het probably benign 0.081 phenotype 11/12/2019
6 594291 UTSW Cacna1g 0.611 R7706 G1 225.01 Y 11 94415041 I1941V T C missense Het probably benign 0.057 phenotype 11/12/2019
7 594307 UTSW Capn15 0.349 R7706 G1 225.01 Y 17 25964151 V518A A G missense Het probably benign 0.004 0.061 phenotype 11/12/2019
8 594260 UTSW Chst10 0.377 R7706 G1 225.01 Y 1 38866025 Y200N A T missense Het probably damaging 0.990 phenotype 11/12/2019
9 594263 UTSW Cir1 1.000 R7706 G1 225.01 Y 2 73312479 S4P A G missense Het probably damaging 0.999 0.145 11/12/2019
10 594285 UTSW Cish 0.000 R7706 G1 225.01 Y 9 107300641 R172Q G A missense Het probably benign 0.008 phenotype 11/12/2019
11 594286 UTSW Cnot10 1.000 R7706 G1 225.01 Y 9 114593438 N693K A T missense Het probably damaging 0.975 11/12/2019
12 594282 UTSW Ddx6 1.000 R7706 G1 225.01 Y 9 44627642 D249G A G missense Het probably damaging 1.000 phenotype 11/12/2019
13 594302 UTSW Dennd6b 0.164 R7706 G1 225.01 Y 15 89185244 D528G T C missense Het probably benign 0.190 11/12/2019
14 594272 UTSW Dmtf1 0.830 R7706 G1 225.01 Y 5 9124489 T484S T A missense Het possibly damaging 0.862 phenotype 11/12/2019
15 628485 UTSW Dnaaf5 0.176 R7706 G1 73.01 Y 5 139152841 V259A T C missense Het probably damaging 1.000 phenotype 04/21/2020
16 594284 UTSW Dzip1l 0.166 R7706 G1 225.01 Y 9 99637536 S39C A T missense Het probably damaging 1.000 11/12/2019
17 594264 UTSW Efcab8 0.100 R7706 G1 225.01 Y 2 153781775 M60K T A missense Het 0.099 11/12/2019
18 594278 UTSW Eml2 0.000 R7706 G1 225.01 Y 7 19186110 V113D T A missense Het possibly damaging 0.785 11/12/2019
19 594289 UTSW Fnip1 0.836 R7706 G1 225.01 Y 11 54515499 I1141F A T missense Het probably benign 0.405 phenotype 11/12/2019
20 594277 UTSW Gm7298 0.176 R7706 G1 225.01 Y 6 121735611 S127R T A missense Het probably damaging 0.962 11/12/2019
21 594287 UTSW Hcn2 0.000 R7706 G1 225.01 Y 10 79734183 R622Q G A missense Het possibly damaging 0.784 phenotype 11/12/2019
22 594273 UTSW Ift172 1.000 R7706 G1 225.01 Y 5 31266379 W746* C T nonsense Het probably null phenotype 11/12/2019
23 594261 UTSW Irs1 0.632 R7706 G1 225.01 Y 1 82287691 Y935H A G missense Het probably damaging 1.000 phenotype 11/12/2019
24 594300 UTSW Kctd17 0.000 R7706 G1 217.47 Y 15 78436913 CAGCTGGAGGAGC CAGC unclassified Het probably benign phenotype 11/12/2019
25 594262 UTSW Klhl20 0.228 R7706 G1 225.01 Y 1 161109257 I183V T C missense Het probably benign 0.011 phenotype 11/12/2019
26 594304 UTSW Krt1 0.268 R7706 G1 214.46 N 15 101850378 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC small deletion Het probably benign 0.090 phenotype 11/12/2019
27 594303 UTSW Lalba 0.088 R7706 G1 225.01 Y 15 98481593 D103G T C missense Het probably damaging 0.999 phenotype 11/12/2019
28 594265 UTSW Lpin3 0.000 R7706 G1 225.01 Y 2 160905290 L822P T C missense Het probably damaging 0.995 phenotype 11/12/2019
29 594270 UTSW Lrrc38 0.058 R7706 G1 225.01 Y 4 143350275 C36Y G A missense Het probably damaging 1.000 11/12/2019
30 594299 UTSW Ly6e 1.000 R7706 G1 225.01 Y 15 74958334 S46P T C missense Het possibly damaging 0.896 phenotype 11/12/2019
31 594306 UTSW Narfl 1.000 R7706 G1 225.01 Y 17 25782252 *493Q T C makesense Het probably null 0.904 phenotype 11/12/2019
32 594280 UTSW Nav2 0.633 R7706 G1 225.01 Y 7 49594319 I2098T T C missense Het probably benign 0.349 phenotype 11/12/2019
33 594298 UTSW Nipbl 0.962 R7706 G1 225.01 Y 15 8351526 E594G T C missense Het probably benign 0.009 phenotype 11/12/2019
34 594281 UTSW Olfr552 0.096 R7706 G1 225.01 Y 7 102604646 H97Q T A missense Het probably benign 0.124 phenotype 11/12/2019
35 594305 UTSW Parn 0.953 R7706 G1 225.01 Y 16 13607253 D432G T C missense Het probably damaging 0.996 0.597 phenotype 11/12/2019
36 594296 UTSW Pcdh20 0.000 R7706 G1 225.01 Y 14 88467357 S836P A G missense Het probably damaging 1.000 phenotype 11/12/2019
37 594266 UTSW Pcmtd2 0.098 R7706 G1 225.01 Y 2 181855075 R282C C T missense Het probably damaging 0.999 11/12/2019
38 594293 UTSW Ppp2r3c 0.963 R7706 G1 225.01 Y 12 55281705 I425T A G missense Het probably benign 0.230 phenotype 11/12/2019
39 628488 UTSW Samm50 0.954 R7706 G1 198.01 Y 15 84200880 T A intron 163 bp Het probably null phenotype 04/21/2020
40 594268 UTSW Sars 1.000 R7706 G1 225.01 Y 3 108431464 C T critical splice donor site 1 bp Het probably null phenotype 11/12/2019
41 594283 UTSW Senp8 0.473 R7706 G1 225.01 Y 9 59737838 Y12H A G missense Het possibly damaging 0.924 phenotype 11/12/2019
42 594275 UTSW Slc13a4 0.810 R7706 G1 225.01 Y 6 35270355 I577V T C missense Het possibly damaging 0.915 0.079 phenotype 11/12/2019
43 594290 UTSW Srr 0.280 R7706 G1 225.01 Y 11 74913135 T G critical splice acceptor site Het probably null 0.976 phenotype 11/12/2019
44 594271 UTSW Steap2 0.000 R7706 G1 225.01 Y 5 5682967 N19I T A missense Het possibly damaging 0.951 phenotype 11/12/2019
45 594295 UTSW Sucla2 0.930 R7706 G1 225.01 Y 14 73568993 Y168C A G missense Het probably damaging 1.000 phenotype 11/12/2019
46 594292 UTSW Tha1 0.090 R7706 G1 225.01 Y 11 117869455 Q275R T C missense Het probably damaging 1.000 11/12/2019
47 594274 UTSW Trim56 0.000 R7706 G1 225.01 Y 5 137114656 N2S T C missense Het probably benign 0.001 11/12/2019
48 594301 UTSW Tubgcp6 0.961 R7706 G1 225.01 Y 15 89104223 H849L T A missense Het probably benign 0.000 phenotype 11/12/2019
49 628486 UTSW Uevld 0.000 R7706 G1 225.01 Y 7 46948027 I72T A G missense Het possibly damaging 0.518 04/21/2020
50 594269 UTSW Ybx1 1.000 R7706 G1 225.01 Y 4 119278967 *323Q A G makesense Het probably null phenotype 11/12/2019
51 594288 UTSW Zfp354b 0.066 R7706 G1 225.01 Y 11 50928563 C T critical splice donor site 1 bp Het probably null 11/12/2019
52 594309 UTSW Zfp36l2 0.822 R7706 G1 225.01 Y 17 84186918 L97Q A T missense Het probably benign 0.193 phenotype 11/12/2019
53 594294 UTSW Zfp729a 0.063 R7706 G1 225.01 Y 13 67623493 R78S T A missense Het possibly damaging 0.724 11/12/2019
[records 1 to 53 of 53]