Incidental Mutations

42 incidental mutations are currently displayed, and affect 42 genes.
7 are Possibly Damaging.
11 are Probably Damaging.
16 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 42 of 42] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 594739 UTSW 1700113H08Rik 0.073 R7713 G1 225.01 N 10 87230311 S119P T C missense Het possibly damaging 0.804 11/12/2019
2 594749 UTSW Agtpbp1 0.857 R7713 G1 225.01 N 13 59514152 I282F T A missense Het probably damaging 0.993 0.117 phenotype 11/12/2019
3 594724 UTSW Armh1 0.096 R7713 G1 225.01 N 4 117214228 M355K A T missense Het possibly damaging 0.655 11/12/2019
4 594752 UTSW BC067074 0.224 R7713 G1 225.01 N 13 113346541 V1559G T G missense Het 11/12/2019
5 594748 UTSW Cep128 0.185 R7713 G1 225.01 N 12 91019322 D1013E A T missense Het probably benign 0.070 11/12/2019
6 594727 UTSW Clock 0.795 R7713 G1 225.01 N 5 76245420 A T critical splice donor site 2 bp Het probably null phenotype 11/12/2019
7 594719 UTSW D630003M21Rik 0.065 R7713 G1 225.01 N 2 158216778 Q401* G A nonsense Het probably null 11/12/2019
8 594745 UTSW Dnah17 0.000 R7713 G1 225.01 N 11 118025171 V4302L C A missense Het probably benign 0.022 phenotype 11/12/2019
9 594741 UTSW Drc3 0.103 R7713 G1 225.01 N 11 60370560 Y179C A G missense Het probably benign 0.000 11/12/2019
10 594740 UTSW Erbb3 1.000 R7713 G1 225.01 N 10 128574449 T647A T C missense Het probably benign 0.000 phenotype 11/12/2019
11 594733 UTSW Esrp2 0.000 R7713 G1 225.01 N 8 106134276 T205A T C missense Het probably benign 0.007 phenotype 11/12/2019
12 594721 UTSW Fbxw7 1.000 R7713 G1 225.01 N 3 84967565 T C critical splice donor site 2 bp Het probably null phenotype 11/12/2019
13 594718 UTSW Fmn1 0.320 R7713 G1 225.01 N 2 113525814 P965S C T missense Het unknown phenotype 11/12/2019
14 594722 UTSW Fndc7 0.000 R7713 G1 225.01 N 3 108870663 V412M C T missense Het possibly damaging 0.899 11/12/2019
15 594747 UTSW G2e3 0.561 R7713 G1 225.01 N 12 51369056 A525E C A missense Het probably damaging 0.991 phenotype 11/12/2019
16 594728 UTSW Gcfc2 0.394 R7713 G1 225.01 N 6 81941390 R354C C T missense Het probably damaging 1.000 phenotype 11/12/2019
17 594738 UTSW Ggt1 0.084 R7713 G1 225.01 N 10 75585674 N510K T A missense Het probably damaging 0.995 phenotype 11/12/2019
18 594720 UTSW Gnas 1.000 R7713 G1 225.01 N 2 174299027 T389I C T missense Het unknown phenotype 11/12/2019
19 594730 UTSW Hapln3 0.070 R7713 G1 225.01 N 7 79117373 R306H C T missense Het probably benign 0.001 phenotype 11/12/2019
20 594734 UTSW Hydin 0.628 R7713 G1 225.01 N 8 110593812 L4496P T C missense Het possibly damaging 0.692 phenotype 11/12/2019
21 594751 UTSW Iqgap2 0.000 R7713 G1 225.01 N 13 95731444 I219L T A missense Het probably benign 0.015 phenotype 11/12/2019
22 594744 UTSW Kcnj2 1.000 R7713 G1 225.01 N 11 111072483 S234P T C missense Het probably benign 0.002 phenotype 11/12/2019
23 594756 UTSW Lipf 0.187 R7713 G1 225.01 N 19 33973065 S286T T A missense Het probably damaging 1.000 phenotype 11/12/2019
24 594731 UTSW Lrrc32 0.266 R7713 G1 225.01 N 7 98499338 G442W G T missense Het probably damaging 0.987 phenotype 11/12/2019
25 594755 UTSW Megf10 0.445 R7713 G1 217.47 N 18 57293999 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA unclassified Het probably benign 0.090 phenotype 11/12/2019
26 594743 UTSW Mtmr4 0.215 R7713 G1 225.01 N 11 87597724 V68A T C missense Het probably damaging 0.998 11/12/2019
27 594729 UTSW Mug2 0.096 R7713 G1 225.01 N 6 122078795 S1146P T C missense Het possibly damaging 0.832 11/12/2019
28 594750 UTSW Naa35 0.963 R7713 G1 225.01 N 13 59598105 I75T T C missense Het probably benign 0.015 11/12/2019
29 594737 UTSW Nepn 0.000 R7713 G1 225.01 N 10 52401178 F337I T A missense Het probably benign 0.160 11/12/2019
30 594742 UTSW Nf1 1.000 R7713 G1 225.01 N 11 79425606 M496V A G missense Het probably benign 0.000 phenotype 11/12/2019
31 594754 UTSW Nthl1 0.000 R7713 G1 225.01 N 17 24638657 I277F A T missense Het possibly damaging 0.769 phenotype 11/12/2019
32 594716 UTSW Olfr1208 0.070 R7713 G1 145.01 N 2 88897778 T C start gained Het probably benign phenotype 11/12/2019
33 594732 UTSW Olfr518 0.092 R7713 G1 225.01 N 7 108880682 I308S A C missense Het probably damaging 1.000 phenotype 11/12/2019
34 594746 UTSW Osr1 0.825 R7713 G1 225.01 N 12 9579253 Y42F A T missense Het probably damaging 1.000 phenotype 11/12/2019
35 594736 UTSW Rad54l2 1.000 R7713 G1 225.01 N 9 106717223 R369W G A missense Het probably damaging 1.000 phenotype 11/12/2019
36 594717 UTSW Ryr3 0.338 R7713 G1 225.01 N 2 112635346 T4828S T A missense Het probably benign 0.121 phenotype 11/12/2019
37 594723 UTSW Slc25a54 0.203 R7713 G1 225.01 N 3 109102817 C211S T A missense Het probably damaging 0.993 11/12/2019
38 594726 UTSW Ube4b 1.000 R7713 G1 225.01 N 4 149398781 R10Q C T missense Het possibly damaging 0.533 phenotype 11/12/2019
39 594757 UTSW Usp9y 0.064 R7713 G1 222 N Y 1304411 Q2440* G A nonsense Het probably null phenotype 11/12/2019
40 594725 UTSW Yars 1.000 R7713 G1 225.01 N 4 129210498 V312L G T missense Het probably benign 0.001 phenotype 11/12/2019
41 594735 UTSW Zfp26 0.120 R7713 G1 225.01 N 9 20441334 T145I G A missense Het probably benign 0.076 phenotype 11/12/2019
42 594753 UTSW Zic5 1.000 R7713 G1 225.01 N 14 122464113 N402S T C missense Het unknown phenotype 11/12/2019
[records 1 to 42 of 42]