Incidental Mutations

42 incidental mutations are currently displayed, and affect 42 genes.
7 are Possibly Damaging.
11 are Probably Damaging.
16 are Probably Benign.
4 are Probably Null.
2 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 42 of 42] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 594739 UTSW 1700113H08Rik 0.061 R7713 G1 225.01 N 10 87230311 S119P T C missense Het possibly damaging 0.804 11/12/2019
2 594749 UTSW Agtpbp1 0.761 R7713 G1 225.01 N 13 59514152 I282F T A missense Het probably damaging 0.993 0.117 phenotype 11/12/2019
3 594724 UTSW Armh1 0.072 R7713 G1 225.01 N 4 117214228 M355K A T missense Het possibly damaging 0.655 11/12/2019
4 594752 UTSW BC067074 0.245 R7713 G1 225.01 N 13 113346541 V1559G T G missense Het 11/12/2019
5 594748 UTSW Cep128 0.204 R7713 G1 225.01 N 12 91019322 D1013E A T missense Het probably benign 0.070 11/12/2019
6 594727 UTSW Clock 0.790 R7713 G1 225.01 N 5 76245420 A T critical splice donor site 2 bp Het probably null phenotype 11/12/2019
7 594719 UTSW D630003M21Rik 0.066 R7713 G1 225.01 N 2 158216778 Q401* G A nonsense Het probably null 11/12/2019
8 594745 UTSW Dnah17 0.000 R7713 G1 225.01 N 11 118025171 V4302L C A missense Het probably benign 0.022 phenotype 11/12/2019
9 594741 UTSW Drc3 0.089 R7713 G1 225.01 N 11 60370560 Y179C A G missense Het probably benign 0.000 11/12/2019
10 594740 UTSW Erbb3 1.000 R7713 G1 225.01 N 10 128574449 T647A T C missense Het probably benign 0.000 phenotype 11/12/2019
11 594733 UTSW Esrp2 0.000 R7713 G1 225.01 N 8 106134276 T205A T C missense Het probably benign 0.007 phenotype 11/12/2019
12 594721 UTSW Fbxw7 1.000 R7713 G1 225.01 N 3 84967565 T C critical splice donor site 2 bp Het probably null phenotype 11/12/2019
13 594718 UTSW Fmn1 0.295 R7713 G1 225.01 N 2 113525814 P965S C T missense Het unknown phenotype 11/12/2019
14 594722 UTSW Fndc7 0.000 R7713 G1 225.01 N 3 108870663 V412M C T missense Het possibly damaging 0.899 11/12/2019
15 594747 UTSW G2e3 0.572 R7713 G1 225.01 N 12 51369056 A525E C A missense Het probably damaging 0.991 phenotype 11/12/2019
16 594728 UTSW Gcfc2 0.466 R7713 G1 225.01 N 6 81941390 R354C C T missense Het probably damaging 1.000 phenotype 11/12/2019
17 594738 UTSW Ggt1 0.097 R7713 G1 225.01 N 10 75585674 N510K T A missense Het probably damaging 0.995 phenotype 11/12/2019
18 594720 UTSW Gnas 1.000 R7713 G1 225.01 N 2 174299027 T389I C T missense Het unknown phenotype 11/12/2019
19 594730 UTSW Hapln3 0.064 R7713 G1 225.01 N 7 79117373 R306H C T missense Het probably benign 0.001 phenotype 11/12/2019
20 594734 UTSW Hydin 0.792 R7713 G1 225.01 N 8 110593812 L4496P T C missense Het possibly damaging 0.692 phenotype 11/12/2019
21 594751 UTSW Iqgap2 0.000 R7713 G1 225.01 N 13 95731444 I219L T A missense Het probably benign 0.015 phenotype 11/12/2019
22 594744 UTSW Kcnj2 1.000 R7713 G1 225.01 N 11 111072483 S234P T C missense Het probably benign 0.002 phenotype 11/12/2019
23 594756 UTSW Lipf 0.124 R7713 G1 225.01 N 19 33973065 S286T T A missense Het probably damaging 1.000 phenotype 11/12/2019
24 594731 UTSW Lrrc32 0.398 R7713 G1 225.01 N 7 98499338 G442W G T missense Het probably damaging 0.987 phenotype 11/12/2019
25 594755 UTSW Megf10 0.579 R7713 G1 217.47 N 18 57293999 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA unclassified Het probably benign 0.090 phenotype 11/12/2019
26 594743 UTSW Mtmr4 0.187 R7713 G1 225.01 N 11 87597724 V68A T C missense Het probably damaging 0.998 11/12/2019
27 594729 UTSW Mug2 0.057 R7713 G1 225.01 N 6 122078795 S1146P T C missense Het possibly damaging 0.832 11/12/2019
28 594750 UTSW Naa35 0.962 R7713 G1 225.01 N 13 59598105 I75T T C missense Het probably benign 0.015 11/12/2019
29 594737 UTSW Nepn 0.000 R7713 G1 225.01 N 10 52401178 F337I T A missense Het probably benign 0.160 11/12/2019
30 594742 UTSW Nf1 1.000 R7713 G1 225.01 N 11 79425606 M496V A G missense Het probably benign 0.000 phenotype 11/12/2019
31 594754 UTSW Nthl1 0.000 R7713 G1 225.01 N 17 24638657 I277F A T missense Het possibly damaging 0.769 phenotype 11/12/2019
32 594716 UTSW Olfr1208 0.055 R7713 G1 145.01 N 2 88897778 T C start gained Het probably benign phenotype 11/12/2019
33 594732 UTSW Olfr518 0.130 R7713 G1 225.01 N 7 108880682 I308S A C missense Het probably damaging 1.000 phenotype 11/12/2019
34 594746 UTSW Osr1 0.749 R7713 G1 225.01 N 12 9579253 Y42F A T missense Het probably damaging 1.000 phenotype 11/12/2019
35 594736 UTSW Rad54l2 1.000 R7713 G1 225.01 N 9 106717223 R369W G A missense Het probably damaging 1.000 phenotype 11/12/2019
36 594717 UTSW Ryr3 0.399 R7713 G1 225.01 N 2 112635346 T4828S T A missense Het probably benign 0.121 phenotype 11/12/2019
37 594723 UTSW Slc25a54 0.148 R7713 G1 225.01 N 3 109102817 C211S T A missense Het probably damaging 0.993 11/12/2019
38 594726 UTSW Ube4b 1.000 R7713 G1 225.01 N 4 149398781 R10Q C T missense Het possibly damaging 0.533 phenotype 11/12/2019
39 594757 UTSW Usp9y 0.064 R7713 G1 222 N Y 1304411 Q2440* G A nonsense Het probably null phenotype 11/12/2019
40 594725 UTSW Yars 1.000 R7713 G1 225.01 N 4 129210498 V312L G T missense Het probably benign 0.001 phenotype 11/12/2019
41 594735 UTSW Zfp26 0.112 R7713 G1 225.01 N 9 20441334 T145I G A missense Het probably benign 0.076 phenotype 11/12/2019
42 594753 UTSW Zic5 1.000 R7713 G1 225.01 N 14 122464113 N402S T C missense Het unknown phenotype 11/12/2019
[records 1 to 42 of 42]