Incidental Mutations

70 incidental mutations are currently displayed, and affect 68 genes.
10 are Possibly Damaging.
23 are Probably Damaging.
26 are Probably Benign.
8 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 594824 UTSW 1700019A02Rik 0.113 R7715 G1 225.01 Y 1 53182500 F57L A G missense Het probably benign 0.000 0.090 11/12/2019
2 594833 UTSW Agl 0.359 R7715 G1 225.01 Y 3 116758256 R563Q C T missense Het 0.094 phenotype 11/12/2019
3 594828 UTSW Ahctf1 1.000 R7715 G1 225.01 Y 1 179770848 M919T A G missense Het probably benign 0.004 phenotype 11/12/2019
4 594864 UTSW Ano4 0.000 R7715 G1 225.01 Y 10 88995311 N483K A T missense Het probably damaging 0.989 11/12/2019
5 594861 UTSW Armt1 0.137 R7715 G1 225.01 Y 10 4450751 K166R A G missense Het probably benign 0.006 11/12/2019
6 594870 UTSW Asgr2 0.088 R7715 G1 225.01 Y 11 70096895 V73A T C missense Het probably benign 0.011 0.162 phenotype 11/12/2019
7 594842 UTSW Atp6v0a2 0.191 R7715 G1 225.01 Y 5 124714198 T564P A C missense Het probably damaging 0.992 phenotype 11/12/2019
8 594873 UTSW B3gntl1 0.145 R7715 G1 225.01 Y 11 121639796 T150A T C missense Het possibly damaging 0.928 0.270 11/12/2019
9 594883 UTSW Bach1 0.000 R7715 G1 225.01 Y 16 87719971 I467V A G missense Het possibly damaging 0.822 phenotype 11/12/2019
10 594847 UTSW Bicd1 0.000 R7715 G1 225.01 Y 6 149512973 K395E A G missense Het probably benign 0.110 phenotype 11/12/2019
11 594882 UTSW C330027C09Rik 0.930 R7715 G1 225.01 Y 16 49013984 Q643L A T missense Het probably damaging 0.994 phenotype 11/12/2019
12 594878 UTSW Cadps 1.000 R7715 G1 225.01 Y 14 12457762 P1040S G A missense Het probably benign 0.006 phenotype 11/12/2019
13 594871 UTSW Calcoco2 0.000 R7715 G1 103.46 N 11 96100036 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC frame shift Het probably null 11/12/2019
14 594867 UTSW Canx 0.933 R7715 G1 225.01 Y 11 50310804 S80P A G missense Het probably benign 0.129 phenotype 11/12/2019
15 594838 UTSW Ccdc149 0.116 R7715 G1 225.01 Y 5 52404191 T A critical splice acceptor site Het probably null 11/12/2019
16 594830 UTSW Cd34 0.063 R7715 G1 225.01 Y 1 194949316 N87Y A T missense Het probably damaging 0.981 phenotype 11/12/2019
17 594853 UTSW Cdh11 0.000 R7715 G1 225.01 Y 8 102664714 I297F T A missense Het possibly damaging 0.662 phenotype 11/12/2019
18 594880 UTSW Col14a1 0.000 R7715 G1 225.01 Y 15 55487983 I1569V A G missense Het unknown phenotype 11/12/2019
19 594827 UTSW Cxcr4 0.478 R7715 G1 225.01 Y 1 128589742 V61M C T missense Het probably damaging 1.000 phenotype 11/12/2019
20 594825 UTSW Cyp20a1 0.000 R7715 G1 225.01 Y 1 60372605 V271M G A missense Het probably benign 0.002 0.090 phenotype 11/12/2019
21 594848 UTSW Cyp2b23 0.102 R7715 G1 225.01 Y 7 26681695 Y79C T C missense Het probably benign 0.000 11/12/2019
22 594874 UTSW Daam1 1.000 R7715 G1 225.01 Y 12 71988901 K957E A G missense Het probably benign 0.147 phenotype 11/12/2019
23 594877 UTSW Dip2c 0.729 R7715 G1 225.01 Y 13 9614391 K947E A G missense Het probably damaging 0.998 phenotype 11/12/2019
24 594845 UTSW Efcab12 0.068 R7715 G1 225.01 Y 6 115823543 K173R T C missense Het possibly damaging 0.852 0.179 11/12/2019
25 594836 UTSW Emc1 0.965 R7715 G1 225.01 Y 4 139371623 R806C C T missense Het probably damaging 1.000 phenotype 11/12/2019
26 594886 UTSW Epg5 0.952 R7715 G1 225.01 Y 18 77968586 R816Q G A missense Het probably damaging 0.999 phenotype 11/12/2019
27 594835 UTSW Faf1 1.000 R7715 G1 225.01 Y 4 109710814 D24Y G T missense Het probably damaging 0.988 phenotype 11/12/2019
28 628325 UTSW Fchsd1 0.118 R7715 G1 225.01 Y 18 37966642 A T splice site Het probably null 0.976 03/05/2020
29 594844 UTSW Foxp1 1.000 R7715 G1 225.01 Y 6 98945660 T404A T C missense Het unknown phenotype 11/12/2019
30 594888 UTSW Fra10ac1 0.893 R7715 G1 225.01 Y 19 38189838 E299G T C missense Het probably damaging 0.995 phenotype 11/12/2019
31 594832 UTSW Gon4l 0.825 R7715 G1 225.01 Y 3 88908006 T1959A A G missense Het probably benign 0.000 phenotype 11/12/2019
32 594889 UTSW Gpam 0.234 R7715 G1 225.01 Y 19 55088921 V146G A C missense Het probably benign 0.187 phenotype 11/12/2019
33 594854 UTSW Hephl1 0.082 R7715 G1 225.01 Y 9 15060785 D953V T A missense Het probably benign 0.360 11/12/2019
34 594865 UTSW Kcnc2 0.000 R7715 G1 225.01 Y 10 112271940 E79* G T nonsense Het probably null phenotype 11/12/2019
35 594868 UTSW Kcnj12 0.000 R7715 G1 225.01 Y 11 61066952 T A critical splice donor site 2 bp Het probably null 0.976 phenotype 11/12/2019
36 594872 UTSW Llgl2 0.583 R7715 G1 225.01 Y 11 115849728 T417S A T missense Het probably benign 0.000 phenotype 11/12/2019
37 594837 UTSW Lrrc17 0.000 R7715 G1 225.01 Y 5 21561080 N187Y A T missense Het probably damaging 1.000 phenotype 11/12/2019
38 594876 UTSW Macc1 0.074 R7715 G1 225.01 Y 12 119446256 A253V C T missense Het possibly damaging 0.722 phenotype 11/12/2019
39 594829 UTSW Mark1 0.324 R7715 G1 225.01 Y 1 184907234 S529P A G missense Het probably damaging 0.983 11/12/2019
40 594869 UTSW Mfsd6l 0.075 R7715 G1 225.01 Y 11 68557550 L409P T C missense Het probably damaging 1.000 0.618 11/12/2019
41 594852 UTSW Nek1 0.000 R7715 G1 225.01 Y 8 61006760 E34G A G missense Het probably damaging 0.983 phenotype 11/12/2019
42 628321 UTSW Nlrp3 0.091 R7715 G1 181.01 Y 11 59543003 T A splice site Het probably null 0.976 phenotype 03/05/2020
43 594826 UTSW Obsl1 0.196 R7715 G1 225.01 Y 1 75502036 V686D A T missense Het probably damaging 0.992 11/12/2019
44 594858 UTSW Olfr1537 0.105 R7715 G1 225.01 Y 9 39237878 L182H A T missense Het probably damaging 0.999 phenotype 11/12/2019
45 594881 UTSW Olfr167 0.188 R7715 G1 225.01 Y 16 19514730 R302K C T missense Het probably benign 0.003 phenotype 11/12/2019
46 594850 UTSW Olfr545 0.076 R7715 G1 225.01 Y 7 102494461 M105L T A missense Het possibly damaging 0.908 phenotype 11/12/2019
47 594855 UTSW Olfr871 0.067 R7715 G1 225.01 Y 9 20212435 G29R G A missense Het probably damaging 0.971 phenotype 11/12/2019
48 594856 UTSW Olfr871 0.067 R7715 G1 225.01 Y 9 20212436 G29E G A missense Het probably benign 0.064 phenotype 11/12/2019
49 594857 UTSW Olfr893 0.062 R7715 G1 225.01 Y 9 38209479 M140K T A missense Het probably benign 0.300 phenotype 11/12/2019
50 594863 UTSW Ostm1 0.250 R7715 G1 225.01 Y 10 42683187 G148R G A missense Het probably benign 0.000 phenotype 11/12/2019
51 594860 UTSW Oxsr1 1.000 R7715 G1 225.01 Y 9 119242756 S470P A G missense Het probably damaging 1.000 0.215 phenotype 11/12/2019
52 594887 UTSW Pacs1 0.000 R7715 G1 225.01 Y 19 5141681 M709I C T missense Het probably benign 0.013 phenotype 11/12/2019
53 594866 UTSW Pan2 1.000 R7715 G1 225.01 Y 10 128317723 M963V A G missense Het probably benign 0.005 phenotype 11/12/2019
54 594839 UTSW Pds5a 1.000 R7715 G1 225.01 Y 5 65638561 L662P A G missense Het possibly damaging 0.956 phenotype 11/12/2019
55 594849 UTSW Rsf1 1.000 R7715 G1 217.47 N 7 97579912 GGCGGCGGC GGCGGCGGCCGCGGCGGC unclassified Het probably benign phenotype 11/12/2019
56 594843 UTSW Sh2b2 0.905 R7715 G1 225.01 Y 5 136219035 N554S T C missense Het probably benign 0.089 phenotype 11/12/2019
57 628314 UTSW Sh3gl2 0.000 R7715 G1 225.01 Y 4 85398840 T A splice site Het probably null phenotype 03/05/2020
58 594875 UTSW Slc24a4 0.000 R7715 G1 225.01 Y 12 102218960 M93V A G missense Het possibly damaging 0.890 phenotype 11/12/2019
59 594831 UTSW Sohlh1 0.110 R7715 G1 225.01 Y 2 25844628 S218P A G missense Het possibly damaging 0.734 phenotype 11/12/2019
60 594885 UTSW Spast 0.000 R7715 G1 225.01 Y 17 74368926 N321K T A missense Het probably benign 0.011 phenotype 11/12/2019
61 594851 UTSW Srcap 0.964 R7715 G1 225.01 Y 7 127549288 I1936S T G missense Het probably damaging 0.991 phenotype 11/12/2019
62 594862 UTSW Themis 0.155 R7715 G1 225.01 Y 10 28863309 V592I G A missense Het probably benign 0.016 phenotype 11/12/2019
63 594846 UTSW Tnfrsf1a 0.000 R7715 G1 225.01 Y 6 125361414 T296I C T missense Het possibly damaging 0.648 0.179 phenotype 11/12/2019
64 594859 UTSW Ttk 0.953 R7715 G1 225.01 Y 9 83865153 T682A A G missense Het probably benign 0.104 0.090 phenotype 11/12/2019
65 594834 UTSW Virma 1.000 R7715 G1 225.01 Y 4 11549682 R1807W C T missense Het probably damaging 0.998 0.647 11/12/2019
66 628313 UTSW Virma 1.000 R7715 G1 225.01 Y 4 11513016 A G splice site Het probably null 0.976 03/05/2020
67 594884 UTSW Vmn2r101 0.100 R7715 G1 225.01 Y 17 19611915 D724E T A missense Het probably damaging 0.999 11/12/2019
68 594840 UTSW Vmn2r11 0.073 R7715 G1 145.01 N 5 109047441 V673A A G missense Het probably damaging 0.989 11/12/2019
69 594879 UTSW Wbp4 0.912 R7715 G1 225.01 Y 14 79466294 S271N C T missense Het probably benign 0.000 phenotype 11/12/2019
70 594841 UTSW Wdr66 0.100 R7715 G1 225.01 Y 5 123262134 N439D A G missense Het probably damaging 1.000 phenotype 11/12/2019
[records 1 to 70 of 70]