Incidental Mutations

66 incidental mutations are currently displayed, and affect 65 genes.
10 are Possibly Damaging.
23 are Probably Damaging.
26 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 594824 UTSW 1700019A02Rik 0.131 R7715 G1 225.01 N 1 53182500 F57L A G missense Het probably benign 0.000 11/12/2019
2 594833 UTSW Agl 0.250 R7715 G1 225.01 N 3 116758256 R563Q C T missense Het phenotype 11/12/2019
3 594828 UTSW Ahctf1 1.000 R7715 G1 225.01 N 1 179770848 M919T A G missense Het probably benign 0.004 phenotype 11/12/2019
4 594864 UTSW Ano4 0.000 R7715 G1 225.01 N 10 88995311 N483K A T missense Het probably damaging 0.989 11/12/2019
5 594861 UTSW Armt1 0.146 R7715 G1 225.01 N 10 4450751 K166R A G missense Het probably benign 0.006 11/12/2019
6 594870 UTSW Asgr2 0.097 R7715 G1 225.01 N 11 70096895 V73A T C missense Het probably benign 0.011 phenotype 11/12/2019
7 594842 UTSW Atp6v0a2 0.219 R7715 G1 225.01 N 5 124714198 T564P A C missense Het probably damaging 0.992 phenotype 11/12/2019
8 594873 UTSW B3gntl1 0.147 R7715 G1 225.01 N 11 121639796 T150A T C missense Het possibly damaging 0.928 11/12/2019
9 594883 UTSW Bach1 0.000 R7715 G1 225.01 N 16 87719971 I467V A G missense Het possibly damaging 0.822 phenotype 11/12/2019
10 594847 UTSW Bicd1 0.000 R7715 G1 225.01 N 6 149512973 K395E A G missense Het probably benign 0.110 phenotype 11/12/2019
11 594882 UTSW C330027C09Rik 0.962 R7715 G1 225.01 N 16 49013984 Q643L A T missense Het probably damaging 0.994 phenotype 11/12/2019
12 594878 UTSW Cadps 1.000 R7715 G1 225.01 N 14 12457762 P1040S G A missense Het probably benign 0.006 phenotype 11/12/2019
13 594871 UTSW Calcoco2 0.000 R7715 G1 103.46 N 11 96100036 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC frame shift Het probably null 11/12/2019
14 594867 UTSW Canx 0.642 R7715 G1 225.01 N 11 50310804 S80P A G missense Het probably benign 0.129 phenotype 11/12/2019
15 594838 UTSW Ccdc149 0.090 R7715 G1 225.01 N 5 52404191 T A critical splice acceptor site Het probably null 11/12/2019
16 594830 UTSW Cd34 0.082 R7715 G1 225.01 N 1 194949316 N87Y A T missense Het probably damaging 0.981 phenotype 11/12/2019
17 594853 UTSW Cdh11 0.000 R7715 G1 225.01 N 8 102664714 I297F T A missense Het possibly damaging 0.662 phenotype 11/12/2019
18 594880 UTSW Col14a1 0.000 R7715 G1 225.01 N 15 55487983 I1569V A G missense Het unknown phenotype 11/12/2019
19 594827 UTSW Cxcr4 0.492 R7715 G1 225.01 N 1 128589742 V61M C T missense Het probably damaging 1.000 phenotype 11/12/2019
20 594825 UTSW Cyp20a1 0.000 R7715 G1 225.01 N 1 60372605 V271M G A missense Het probably benign 0.002 phenotype 11/12/2019
21 594848 UTSW Cyp2b23 0.090 R7715 G1 225.01 N 7 26681695 Y79C T C missense Het probably benign 0.000 11/12/2019
22 594874 UTSW Daam1 1.000 R7715 G1 225.01 N 12 71988901 K957E A G missense Het probably benign 0.147 phenotype 11/12/2019
23 594877 UTSW Dip2c 0.568 R7715 G1 225.01 N 13 9614391 K947E A G missense Het probably damaging 0.998 phenotype 11/12/2019
24 594845 UTSW Efcab12 0.129 R7715 G1 225.01 N 6 115823543 K173R T C missense Het possibly damaging 0.852 11/12/2019
25 594836 UTSW Emc1 0.963 R7715 G1 225.01 N 4 139371623 R806C C T missense Het probably damaging 1.000 phenotype 11/12/2019
26 594886 UTSW Epg5 0.937 R7715 G1 225.01 N 18 77968586 R816Q G A missense Het probably damaging 0.999 phenotype 11/12/2019
27 594835 UTSW Faf1 1.000 R7715 G1 225.01 N 4 109710814 D24Y G T missense Het probably damaging 0.988 phenotype 11/12/2019
28 594844 UTSW Foxp1 1.000 R7715 G1 225.01 N 6 98945660 T404A T C missense Het unknown phenotype 11/12/2019
29 594888 UTSW Fra10ac1 0.855 R7715 G1 225.01 N 19 38189838 E299G T C missense Het probably damaging 0.995 phenotype 11/12/2019
30 594832 UTSW Gon4l 0.816 R7715 G1 225.01 N 3 88908006 T1959A A G missense Het probably benign 0.000 phenotype 11/12/2019
31 594889 UTSW Gpam 0.289 R7715 G1 225.01 N 19 55088921 V146G A C missense Het probably benign 0.187 phenotype 11/12/2019
32 594854 UTSW Hephl1 0.085 R7715 G1 225.01 N 9 15060785 D953V T A missense Het probably benign 0.360 11/12/2019
33 594865 UTSW Kcnc2 0.000 R7715 G1 225.01 N 10 112271940 E79* G T nonsense Het probably null phenotype 11/12/2019
34 594868 UTSW Kcnj12 0.000 R7715 G1 225.01 N 11 61066952 T A critical splice donor site 2 bp Het probably null phenotype 11/12/2019
35 594872 UTSW Llgl2 0.253 R7715 G1 225.01 N 11 115849728 T417S A T missense Het probably benign 0.000 phenotype 11/12/2019
36 594837 UTSW Lrrc17 0.000 R7715 G1 225.01 N 5 21561080 N187Y A T missense Het probably damaging 1.000 phenotype 11/12/2019
37 594876 UTSW Macc1 0.089 R7715 G1 225.01 N 12 119446256 A253V C T missense Het possibly damaging 0.722 phenotype 11/12/2019
38 594829 UTSW Mark1 0.345 R7715 G1 225.01 N 1 184907234 S529P A G missense Het probably damaging 0.983 11/12/2019
39 594869 UTSW Mfsd6l 0.104 R7715 G1 225.01 N 11 68557550 L409P T C missense Het probably damaging 1.000 11/12/2019
40 594852 UTSW Nek1 0.000 R7715 G1 225.01 N 8 61006760 E34G A G missense Het probably damaging 0.983 phenotype 11/12/2019
41 594826 UTSW Obsl1 0.239 R7715 G1 225.01 N 1 75502036 V686D A T missense Het probably damaging 0.992 11/12/2019
42 594858 UTSW Olfr1537 0.133 R7715 G1 225.01 N 9 39237878 L182H A T missense Het probably damaging 0.999 phenotype 11/12/2019
43 594881 UTSW Olfr167 0.148 R7715 G1 225.01 N 16 19514730 R302K C T missense Het probably benign 0.003 phenotype 11/12/2019
44 594850 UTSW Olfr545 0.105 R7715 G1 225.01 N 7 102494461 M105L T A missense Het possibly damaging 0.908 phenotype 11/12/2019
45 594855 UTSW Olfr871 0.069 R7715 G1 225.01 N 9 20212435 G29R G A missense Het probably damaging 0.971 phenotype 11/12/2019
46 594856 UTSW Olfr871 0.069 R7715 G1 225.01 N 9 20212436 G29E G A missense Het probably benign 0.064 phenotype 11/12/2019
47 594857 UTSW Olfr893 0.074 R7715 G1 225.01 N 9 38209479 M140K T A missense Het probably benign 0.300 phenotype 11/12/2019
48 594863 UTSW Ostm1 0.337 R7715 G1 225.01 N 10 42683187 G148R G A missense Het probably benign 0.000 phenotype 11/12/2019
49 594860 UTSW Oxsr1 1.000 R7715 G1 225.01 N 9 119242756 S470P A G missense Het probably damaging 1.000 phenotype 11/12/2019
50 594887 UTSW Pacs1 0.000 R7715 G1 225.01 N 19 5141681 M709I C T missense Het probably benign 0.013 phenotype 11/12/2019
51 594866 UTSW Pan2 1.000 R7715 G1 225.01 N 10 128317723 M963V A G missense Het probably benign 0.005 phenotype 11/12/2019
52 594839 UTSW Pds5a 1.000 R7715 G1 225.01 N 5 65638561 L662P A G missense Het possibly damaging 0.956 phenotype 11/12/2019
53 594849 UTSW Rsf1 1.000 R7715 G1 217.47 N 7 97579912 GGCGGCGGC GGCGGCGGCCGCGGCGGC unclassified Het probably benign phenotype 11/12/2019
54 594843 UTSW Sh2b2 0.934 R7715 G1 225.01 N 5 136219035 N554S T C missense Het probably benign 0.089 phenotype 11/12/2019
55 594875 UTSW Slc24a4 0.000 R7715 G1 225.01 N 12 102218960 M93V A G missense Het possibly damaging 0.890 phenotype 11/12/2019
56 594831 UTSW Sohlh1 0.230 R7715 G1 225.01 N 2 25844628 S218P A G missense Het possibly damaging 0.734 phenotype 11/12/2019
57 594885 UTSW Spast 0.000 R7715 G1 225.01 N 17 74368926 N321K T A missense Het probably benign 0.011 phenotype 11/12/2019
58 594851 UTSW Srcap 0.963 R7715 G1 225.01 N 7 127549288 I1936S T G missense Het probably damaging 0.991 phenotype 11/12/2019
59 594862 UTSW Themis 0.152 R7715 G1 225.01 N 10 28863309 V592I G A missense Het probably benign 0.016 phenotype 11/12/2019
60 594846 UTSW Tnfrsf1a 0.000 R7715 G1 225.01 N 6 125361414 T296I C T missense Het possibly damaging 0.648 phenotype 11/12/2019
61 594859 UTSW Ttk 0.946 R7715 G1 225.01 N 9 83865153 T682A A G missense Het probably benign 0.104 phenotype 11/12/2019
62 594834 UTSW Virma 1.000 R7715 G1 225.01 N 4 11549682 R1807W C T missense Het probably damaging 0.998 11/12/2019
63 594884 UTSW Vmn2r101 0.104 R7715 G1 225.01 N 17 19611915 D724E T A missense Het probably damaging 0.999 11/12/2019
64 594840 UTSW Vmn2r11 0.084 R7715 G1 145.01 N 5 109047441 V673A A G missense Het probably damaging 0.989 11/12/2019
65 594879 UTSW Wbp4 0.941 R7715 G1 225.01 N 14 79466294 S271N C T missense Het probably benign 0.000 phenotype 11/12/2019
66 594841 UTSW Wdr66 0.090 R7715 G1 225.01 N 5 123262134 N439D A G missense Het probably damaging 1.000 phenotype 11/12/2019
[records 1 to 66 of 66]