Incidental Mutations

79 incidental mutations are currently displayed, and affect 79 genes.
16 are Possibly Damaging.
29 are Probably Damaging.
24 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 628737 UTSW 4921507P07Rik 0.056 R7718 G1 225.01 Y 6 50589098 G A splice site 13 bp Het probably null 06/18/2020
2 595038 UTSW 9530053A07Rik 0.096 R7718 G1 225.01 Y 7 28147201 F1106S T C missense Het probably damaging 1.000 11/12/2019
3 595031 UTSW A430033K04Rik 0.086 R7718 G1 225.01 Y 5 138647860 H669L A T missense Het possibly damaging 0.730 11/12/2019
4 595070 UTSW A930017K11Rik 0.000 R7718 G1 225.01 Y 17 25947024 R430* T A nonsense Het probably null 11/12/2019
5 595024 UTSW Abcb1a 0.143 R7718 G1 225.01 Y 5 8715788 N700I A T missense Het probably damaging 0.999 phenotype 11/12/2019
6 595041 UTSW Abcc6 0.754 R7718 G1 225.01 Y 7 45977392 K1414E T C missense Het possibly damaging 0.910 0.111 phenotype 11/12/2019
7 595066 UTSW Adcy5 0.218 R7718 G1 225.01 Y 16 35280415 V779A T C missense Het probably benign 0.421 phenotype 11/12/2019
8 595056 UTSW Agap2 0.333 R7718 G1 222.01 Y 10 127079865 S82G A G missense Het possibly damaging 0.682 phenotype 11/12/2019
9 595035 UTSW Aldh1l1 0.000 R7718 G1 225.01 Y 6 90598323 N864S A G missense Het probably damaging 1.000 phenotype 11/12/2019
10 595062 UTSW Ang2 0.074 R7718 G1 225.01 Y 14 51195760 V55E A T missense Het probably benign 0.000 11/12/2019
11 595016 UTSW Ank2 1.000 R7718 G1 225.01 Y 3 126965013 M179T A G missense Het possibly damaging 0.875 phenotype 11/12/2019
12 595080 UTSW Atrnl1 0.211 R7718 G1 225.01 Y 19 57740183 C1090* T A nonsense Het probably null phenotype 11/12/2019
13 595050 UTSW Atxn1l 0.436 R7718 G1 225.01 Y 8 109733234 L132P A G missense Het probably damaging 0.995 phenotype 11/12/2019
14 595059 UTSW Bptf 1.000 R7718 G1 225.01 Y 11 107081456 V862A A G missense Het possibly damaging 0.650 phenotype 11/12/2019
15 595073 UTSW Capn11 0.000 R7718 G1 225.01 Y 17 45643781 K143N C A missense Het probably damaging 1.000 phenotype 11/12/2019
16 595063 UTSW Card6 0.000 R7718 G1 225.01 Y 15 5099787 V709A A G missense Het possibly damaging 0.543 0.080 phenotype 11/12/2019
17 595020 UTSW Cavin4 0.000 R7718 G1 225.01 Y 4 48671984 A143V C T missense Het probably benign 0.143 phenotype 11/12/2019
18 595051 UTSW Cntn5 0.000 R7718 G1 225.01 Y 9 9984128 I160T A G missense Het probably benign 0.000 phenotype 11/12/2019
19 595079 UTSW Cyp2c40 0.078 R7718 G1 225.01 N 19 39767338 N511Y T A missense Het probably benign 0.002 11/12/2019
20 595075 UTSW Dsc2 0.000 R7718 G1 225.01 Y 18 20041778 I480N A T missense Het probably damaging 0.981 phenotype 11/12/2019
21 628736 UTSW Elf2 0.228 R7718 G1 225.01 Y 3 51265964 G T utr 3 prime Het probably benign 06/18/2020
22 595028 UTSW Enoph1 0.252 R7718 G1 225.01 Y 5 100062160 V133A T C missense Het possibly damaging 0.471 11/12/2019
23 595033 UTSW Ezh2 1.000 R7718 G1 225.01 Y 6 47554191 D186E A T missense Het probably benign 0.000 phenotype 11/12/2019
24 595057 UTSW Fam196b 0.088 R7718 G1 225.01 Y 11 34402539 S194P T C missense Het probably benign 0.001 11/12/2019
25 595081 UTSW Gfra1 1.000 R7718 G1 225.01 Y 19 58453457 D14G T C missense Het possibly damaging 0.693 phenotype 11/12/2019
26 595072 UTSW Gm9573 0.126 R7718 G1 225.01 Y 17 35622836 T153A T C missense Het unknown 11/12/2019
27 595047 UTSW Gmip 0.177 R7718 G1 225.01 Y 8 69817733 R698W C T missense Het probably damaging 0.990 phenotype 11/12/2019
28 595025 UTSW Grk4 0.122 R7718 G1 225.01 Y 5 34694816 N135D A G missense Het probably benign 0.000 phenotype 11/12/2019
29 595039 UTSW Hspb6 0.290 R7718 G1 225.01 Y 7 30554347 D95G A G missense Het probably benign 0.019 0.090 phenotype 11/12/2019
30 595043 UTSW Htatip2 0.654 R7718 G1 225.01 Y 7 49770884 H159Q T G missense Het possibly damaging 0.537 0.091 phenotype 11/12/2019
31 595009 UTSW Igfn1 0.094 R7718 G1 225.01 Y 1 135969036 E1264G T C missense Het probably benign 0.000 11/12/2019
32 595048 UTSW Katnb1 1.000 R7718 G1 225.01 Y 8 95095208 V223E T A missense Het possibly damaging 0.777 phenotype 11/12/2019
33 595036 UTSW Klra6 0.054 R7718 G1 157.47 Y 6 130013352 AGG AG frame shift Het probably null phenotype 11/12/2019
34 595022 UTSW Masp2 0.208 R7718 G1 225.01 Y 4 148602747 R29C C T missense Het probably damaging 1.000 phenotype 11/12/2019
35 595006 UTSW Mcm3 1.000 R7718 G1 225.01 Y 1 20817274 C123* A T nonsense Het probably null phenotype 11/12/2019
36 595018 UTSW Mdn1 1.000 R7718 G1 225.01 Y 4 32718420 V2225A T C missense Het probably damaging 0.999 11/12/2019
37 595053 UTSW Me1 0.000 R7718 G1 225.01 Y 9 86679900 L44S A G missense Het probably damaging 1.000 phenotype 11/12/2019
38 595029 UTSW Mlxip 0.221 R7718 G1 225.01 Y 5 123445514 N380S A G missense Het probably benign 0.001 phenotype 11/12/2019
39 595040 UTSW Myh14 0.000 R7718 G1 225.01 Y 7 44661040 V140I C T missense Het probably damaging 0.997 0.127 phenotype 11/12/2019
40 595058 UTSW Myocd 1.000 R7718 G1 225.01 Y 11 65218626 D106E A T missense Het probably damaging 0.997 phenotype 11/12/2019
41 595046 UTSW Oat 0.434 R7718 G1 225.01 Y 7 132558259 I411V T C missense Het probably benign 0.026 phenotype 11/12/2019
42 595014 UTSW Olfr1085 1.000 R7718 G1 225.01 Y 2 86658029 V143A A G missense Het probably benign 0.265 phenotype 11/12/2019
43 595045 UTSW Olfr483 0.095 R7718 G1 225.01 Y 7 108103648 V113A T C missense Het probably benign 0.001 phenotype 11/12/2019
44 595044 UTSW Olfr715 0.278 R7718 G1 225.01 N 7 107128718 V225D A T missense Het probably damaging 1.000 phenotype 11/12/2019
45 595008 UTSW Orc2 0.957 R7718 G1 225.01 Y 1 58480317 H246Q A T missense Het possibly damaging 0.655 phenotype 11/12/2019
46 595023 UTSW Pank4 0.167 R7718 G1 225.01 Y 4 154974643 E411G A G missense Het probably damaging 1.000 phenotype 11/12/2019
47 628735 UTSW Patl2 0.117 R7718 G1 225.01 Y 2 122126774 A T intron Het probably null 06/18/2020
48 595076 UTSW Pcdhb15 0.079 R7718 G1 225.01 Y 18 37475163 N483D A G missense Het probably damaging 1.000 0.588 phenotype 11/12/2019
49 595077 UTSW Pcdhb20 0.080 R7718 G1 225.01 Y 18 37505651 D410G A G missense Het probably damaging 1.000 0.856 phenotype 11/12/2019
50 595027 UTSW Pdcl2 0.083 R7718 G1 225.01 Y 5 76317999 C125R A G missense Het probably damaging 1.000 phenotype 11/12/2019
51 595078 UTSW Peli3 0.155 R7718 G1 225.01 Y 19 4934556 C G critical splice acceptor site Het probably null phenotype 11/12/2019
52 595069 UTSW Pkd1 1.000 R7718 G1 225.01 Y 17 24586500 D3313G A G missense Het probably benign 0.149 phenotype 11/12/2019
53 595064 UTSW Plec 0.792 R7718 G1 225.01 Y 15 76177439 M2766R A C missense Het probably damaging 0.997 phenotype 11/12/2019
54 595026 UTSW Ppargc1a 0.750 R7718 G1 225.01 Y 5 51498162 V99M C T missense Het probably damaging 1.000 phenotype 11/12/2019
55 595037 UTSW Psg19 0.059 R7718 G1 225.01 Y 7 18792443 A374V G A missense Het probably benign 0.054 11/12/2019
56 595049 UTSW Psmd7 1.000 R7718 G1 225.01 Y 8 107586629 F54L A T missense Het possibly damaging 0.953 0.933 phenotype 11/12/2019
57 595015 UTSW Ptbp2 1.000 R7718 G1 225.01 Y 3 119720988 G397R C T missense Het probably null 1.000 phenotype 11/12/2019
58 595074 UTSW Ranbp3 0.952 R7718 G1 225.01 Y 17 56696718 D39G A G missense Het probably damaging 0.993 phenotype 11/12/2019
59 595012 UTSW Rcor3 0.618 R7718 G1 225.01 Y 1 192101721 T406A T C missense Het probably benign 0.002 11/12/2019
60 595021 UTSW Rhbdl2 0.000 R7718 G1 225.01 Y 4 123824919 I222K T A missense Het probably damaging 0.999 0.206 phenotype 11/12/2019
61 595017 UTSW Ripk2 0.180 R7718 G1 225.01 Y 4 16151968 N197S T C missense Het possibly damaging 0.705 0.066 phenotype 11/12/2019
62 595034 UTSW Rpia 1.000 R7718 G1 225.01 Y 6 70766618 M283K A T missense Het probably damaging 0.999 phenotype 11/12/2019
63 595011 UTSW Rps6kc1 0.000 R7718 G1 225.01 Y 1 190871825 D200G T C missense Het probably benign 0.131 11/12/2019
64 595060 UTSW Sipa1l1 0.000 R7718 G1 225.01 Y 12 82342497 K499M A T missense Het probably damaging 1.000 11/12/2019
65 595055 UTSW Slc5a4b 0.140 R7718 G1 225.01 Y 10 76070573 L404P A G missense Het probably damaging 1.000 11/12/2019
66 595067 UTSW Son 0.947 R7718 G1 163.46 N 16 91660334 AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG small deletion Het probably benign phenotype 11/12/2019
67 595032 UTSW St7 0.194 R7718 G1 225.01 Y 6 17854999 T312P A C missense Het probably damaging 0.990 phenotype 11/12/2019
68 595013 UTSW Strbp 0.429 R7718 G1 225.01 Y 2 37625282 E244G T C missense Het probably damaging 1.000 phenotype 11/12/2019
69 595007 UTSW Tbc1d8 0.000 R7718 G1 225.01 Y 1 39376980 T871P T G missense Het probably benign 0.001 11/12/2019
70 595068 UTSW Tcp1 0.937 R7718 G1 225.01 Y 17 12922162 I286N T A missense Het probably damaging 0.995 phenotype 11/12/2019
71 595071 UTSW Tead3 0.000 R7718 G1 225.01 Y 17 28333517 V327F C A missense Het probably damaging 0.998 phenotype 11/12/2019
72 595030 UTSW Tmem132c 0.097 R7718 G1 225.01 Y 5 127563440 T892S A T missense Het probably benign 0.059 11/12/2019
73 595065 UTSW Trmt2a 0.000 R7718 G1 225.01 Y 16 18250623 S65P T C missense Het probably benign 0.160 phenotype 11/12/2019
74 595054 UTSW Ubp1 1.000 R7718 G1 225.01 Y 9 113973529 N479S A G missense Het possibly damaging 0.687 0.164 phenotype 11/12/2019
75 595052 UTSW Ubtfl1 0.141 R7718 G1 225.01 Y 9 18409231 L18F A T missense Het possibly damaging 0.775 11/12/2019
76 595042 UTSW Uevld 0.000 R7718 G1 225.01 Y 7 46938056 M299L T G missense Het probably benign 0.025 0.100 11/12/2019
77 595019 UTSW Unc13b 0.753 R7718 G1 225.01 Y 4 43173854 Y1561N T A missense Het unknown phenotype 11/12/2019
78 595061 UTSW Ylpm1 1.000 R7718 G1 225.01 Y 12 85029122 K874E A G missense Het probably damaging 0.987 11/12/2019
79 595010 UTSW Zbtb37 0.340 R7718 G1 225.01 Y 1 161032232 R168W G A missense Het possibly damaging 0.903 11/12/2019
[records 1 to 79 of 79]