Incidental Mutations

68 incidental mutations are currently displayed, and affect 68 genes.
9 are Possibly Damaging.
25 are Probably Damaging.
18 are Probably Benign.
13 are Probably Null.
6 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 68 of 68] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 596341 UTSW 2410141K09Rik 0.071 R7737 G1 225.01 Y 13 66433677 A G critical splice donor site 2 bp Het probably null 0.944 11/26/2019
2 596318 UTSW 9530053A07Rik 0.184 R7737 G1 225.01 Y 7 28157073 V2095E T A missense Het probably damaging 1.000 11/26/2019
3 628459 UTSW Adamts18 0.136 R7737 G1 225.01 Y 8 113736934 A T splice site Het probably null phenotype 04/20/2020
4 596316 UTSW Akap3 0.100 R7737 G1 225.01 Y 6 126874102 M861K T A missense Het probably damaging 0.998 phenotype 11/26/2019
5 596320 UTSW Ankrd42 0.077 R7737 G1 202.01 Y 7 92605262 T380A T C missense Het possibly damaging 0.528 11/26/2019
6 596315 UTSW Arhgef5 0.000 R7737 G1 225.01 Y 6 43273794 E493G A G missense Het possibly damaging 0.841 0.101 phenotype 11/26/2019
7 596347 UTSW Armc4 0.222 R7737 G1 225.01 Y 18 7217890 L608P A G missense Het probably damaging 1.000 phenotype 11/26/2019
8 596345 UTSW Arvcf 0.000 R7737 G1 225.01 Y 16 18397101 R119Q G A missense Het probably damaging 1.000 phenotype 11/26/2019
9 596353 UTSW Asmt 0.088 R7737 G1 164.01 Y X 170676440 F228S T C missense Het probably damaging 0.983 phenotype 11/26/2019
10 596327 UTSW Atp2c2 0.000 R7737 G1 225.01 Y 8 119742395 V349E T A missense Het probably damaging 0.999 11/26/2019
11 596299 UTSW BC034090 0.061 R7737 G1 225.01 Y 1 155241673 V233A A G missense Het possibly damaging 0.663 0.084 11/26/2019
12 596298 UTSW Brinp3 0.243 R7737 G1 225.01 Y 1 146682594 K85N G T missense Het probably damaging 0.981 0.647 phenotype 11/26/2019
13 596346 UTSW Ccr6 0.000 R7737 G1 225.01 Y 17 8245094 G A start gained Het probably benign 0.090 phenotype 11/26/2019
14 596323 UTSW D7Ertd443e 0.000 R7737 G1 225.01 Y 7 134270201 S644P A G missense Het probably damaging 1.000 11/26/2019
15 596351 UTSW Ddb1 1.000 R7737 G1 225.01 Y 19 10625974 A882V C T missense Het possibly damaging 0.926 0.370 phenotype 11/26/2019
16 596295 UTSW Epha4 0.938 R7737 G1 225.01 Y 1 77381012 G783D C T missense Het probably damaging 1.000 phenotype 11/26/2019
17 596328 UTSW Ephb1 0.000 R7737 G1 225.01 Y 9 101984103 I621F T A missense Het probably damaging 1.000 phenotype 11/26/2019
18 596329 UTSW Fbxw18 0.063 R7737 G1 225.01 Y 9 109701263 Y93* G T nonsense Het probably null 11/26/2019
19 628458 UTSW Gak 1.000 R7737 G1 225.01 Y 5 108617008 L84R A C missense Het probably benign 0.149 phenotype 04/20/2020
20 596311 UTSW Gm21671 R7737 G1 103.47 N 5 25950851 AACT A small deletion Het probably benign 11/26/2019
21 628460 UTSW Gm5458 R7737 G1 225.01 N 14 19599737 A T splice site Het probably null 04/20/2020
22 596308 UTSW Gpatch3 0.092 R7737 G1 215.01 Y 4 133575096 Q113E C G missense Het probably benign 0.009 11/26/2019
23 596340 UTSW Gpld1 0.000 R7737 G1 225.01 Y 13 24975726 L426M C A missense Het probably damaging 1.000 0.336 phenotype 11/26/2019
24 628463 UTSW Ighmbp2 1.000 R7737 G1 225.01 Y 19 3274467 P234S G A missense Het unknown 0.087 phenotype 04/20/2020
25 596304 UTSW Itga6 1.000 R7737 G1 225.01 Y 2 71822443 V217I G A missense Het probably benign 0.382 phenotype 11/26/2019
26 596314 UTSW Kdm7a 0.000 R7737 G1 225.01 Y 6 39144404 N872K A T missense Het probably benign 0.027 phenotype 11/26/2019
27 596348 UTSW Klhl14 0.689 R7737 G1 225.01 Y 18 21558134 Y446* G T nonsense Het probably null phenotype 11/26/2019
28 596338 UTSW Larp4b 0.645 R7737 G1 225.01 Y 13 9170643 T A splice site Het probably null 0.976 phenotype 11/26/2019
29 596297 UTSW Lct 0.000 R7737 G1 225.01 Y 1 128298693 W1320R A T missense Het probably benign 0.117 phenotype 11/26/2019
30 596302 UTSW Lrp2 1.000 R7737 G1 225.01 Y 2 69496438 D1763G T C missense Het possibly damaging 0.771 phenotype 11/26/2019
31 596344 UTSW Lrrk2 0.484 R7737 G1 225.01 Y 15 91815446 N2499Y A T missense Het probably damaging 0.979 phenotype 11/26/2019
32 628461 UTSW Lsg1 0.943 R7737 G1 208.01 Y 16 30581185 T C intron Het probably null phenotype 04/20/2020
33 596305 UTSW Mettl15 0.103 R7737 G1 225.01 Y 2 109137378 K188E T C missense Het probably damaging 0.991 11/26/2019
34 596331 UTSW Mfsd4b1 0.055 R7737 G1 225.01 Y 10 40003278 S208P A G missense Het probably damaging 0.966 11/26/2019
35 596313 UTSW Mlxipl 0.463 R7737 G1 225.01 Y 5 135135381 S793P T C missense Het possibly damaging 0.734 phenotype 11/26/2019
36 596352 UTSW Ms4a14 0.126 R7737 G1 225.01 Y 19 11302786 Q803* G A nonsense Het probably null 0.970 11/26/2019
37 596310 UTSW Mtor 1.000 R7737 G1 225.01 Y 4 148538738 E2015A A C missense Het possibly damaging 0.955 phenotype 11/26/2019
38 596333 UTSW Myo15b 0.063 R7737 G1 225.01 Y 11 115887923 Y2581F A T missense Het unknown 11/26/2019
39 596349 UTSW Myo7b 0.000 R7737 G1 225.01 Y 18 32014204 Y95* A T nonsense Het probably null phenotype 11/26/2019
40 596332 UTSW Nf1 1.000 R7737 G1 225.01 Y 11 79545488 I1985V A G missense Het probably benign 0.333 0.110 phenotype 11/26/2019
41 596337 UTSW Noxred1 0.079 R7737 G1 225.01 Y 12 87221362 Q332* G A nonsense Het probably null 0.964 11/26/2019
42 596326 UTSW Nudt21 1.000 R7737 G1 225.01 Y 8 94022833 Y202N A T missense Het probably damaging 0.999 0.957 phenotype 11/26/2019
43 596300 UTSW Olfr345 0.055 R7737 G1 225.01 Y 2 36640620 I194F A T missense Het probably benign 0.008 phenotype 11/26/2019
44 596322 UTSW Pik3c2a 1.000 R7737 G1 225.01 Y 7 116356253 S1176T A T missense Het probably damaging 0.989 phenotype 11/26/2019
45 596309 UTSW Pramef17 0.052 R7737 G1 225.01 Y 4 143991956 S306A A C missense Het possibly damaging 0.893 11/26/2019
46 596334 UTSW Qrich2 0.064 R7737 G1 110.47 N 11 116457541 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG small deletion Het probably benign 11/26/2019
47 596324 UTSW Rbmxl1 R7737 G1 218.01 N 8 78505623 S364P A G missense Het unknown 11/26/2019
48 596306 UTSW Rnf24 0.000 R7737 G1 225.01 Y 2 131303496 K131N T A missense Het probably benign 0.000 0.090 phenotype 11/26/2019
49 596301 UTSW Scai 0.613 R7737 G1 225.01 Y 2 39123022 Q132L T A missense Het probably damaging 0.961 phenotype 11/26/2019
50 596312 UTSW Sh3tc1 0.095 R7737 G1 225.01 Y 5 35723953 R49G T C missense Het probably benign 0.150 11/26/2019
51 596342 UTSW Slc12a7 0.000 R7737 G1 225.01 Y 13 73788677 E152G A G missense Het probably benign 0.007 0.088 phenotype 11/26/2019
52 596350 UTSW Slc22a27 0.052 R7737 G1 225.01 Y 19 7896762 M316K A T missense Het probably damaging 0.994 0.231 11/26/2019
53 596343 UTSW Spag1 0.723 R7737 G1 225.01 Y 15 36210710 A427S G T missense Het probably benign 0.010 phenotype 11/26/2019
54 596354 UTSW Sry 0.318 R7737 G1 131.46 N Y 2662638 GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG small deletion Het probably benign phenotype 11/26/2019
55 596294 UTSW Stk16 0.000 R7737 G1 225.01 Y 1 75211351 C8F G T missense Het probably damaging 1.000 11/26/2019
56 596336 UTSW Syne2 0.372 R7737 G1 225.01 Y 12 75942848 C1834R T C missense Het probably damaging 1.000 0.363 phenotype 11/26/2019
57 628457 UTSW Tie1 1.000 R7737 G1 225.01 Y 4 118478857 C T splice site 5 bp Het probably null phenotype 04/20/2020
58 596335 UTSW Timp2 0.000 R7737 G1 225.01 Y 11 118303895 I156T A G missense Het probably damaging 0.999 phenotype 11/26/2019
59 596296 UTSW Tmem163 0.076 R7737 G1 225.01 Y 1 127491610 M286T A G missense Het possibly damaging 0.614 phenotype 11/26/2019
60 596307 UTSW Tmx4 0.067 R7737 G1 225.01 Y 2 134639668 M112L T A missense Het probably benign 0.002 phenotype 11/26/2019
61 596330 UTSW Trank1 0.000 R7737 G1 225.01 Y 9 111366012 E1035* G T nonsense Het probably null 11/26/2019
62 596321 UTSW Trim5 0.077 R7737 G1 225.01 Y 7 104279564 V57M C T missense Het probably damaging 1.000 11/26/2019
63 596303 UTSW Ubr3 1.000 R7737 G1 225.01 Y 2 69991566 S1391G A G missense Het probably benign 0.072 phenotype 11/26/2019
64 596317 UTSW Vmn1r72 0.061 R7737 G1 225.01 Y 7 11669707 S271R A T missense Het probably damaging 0.984 11/26/2019
65 628462 UTSW Xpo5 1.000 R7737 G1 225.01 Y 17 46236090 G A intron 89 bp Het probably null phenotype 04/20/2020
66 596319 UTSW Zfp592 0.887 R7737 G1 225.01 Y 7 81025193 H635L A T missense Het probably damaging 1.000 phenotype 11/26/2019
67 596325 UTSW Zfp791 0.000 R7737 G1 225.01 Y 8 85112215 N62K A T missense Het probably benign 0.016 0.095 11/26/2019
68 596339 UTSW Zmynd11 0.713 R7737 G1 225.01 Y 13 9695139 T248M G A missense Het probably damaging 1.000 0.647 phenotype 11/26/2019
[records 1 to 68 of 68]