Incidental Mutations

112 incidental mutations are currently displayed, and affect 111 genes.
19 are Possibly Damaging.
35 are Probably Damaging.
33 are Probably Benign.
18 are Probably Null.
4 create premature stop codons.
11 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 112] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 597009 UTSW 2310057M21Rik 0.076 R7748 G1 225.01 N 7 131361792 L103F T A missense Het probably benign 0.037 11/26/2019
2 596970 UTSW 4932438A13Rik 1.000 R7748 G1 225.01 N 3 36959335 A G critical splice acceptor site Het probably null phenotype 11/26/2019
3 597005 UTSW 5330417H12Rik R7748 G1 225.01 N 7 107624558 L103P A G missense Het unknown 11/26/2019
4 596987 UTSW Actb 1.000 R7748 G1 225.01 N 5 142904695 I151V T C missense Het probably benign 0.000 phenotype 11/26/2019
5 597055 UTSW Adcy6 0.000 R7748 G1 225.01 N 15 98604556 H59L T A missense Het probably benign 0.011 phenotype 11/26/2019
6 596961 UTSW Adss 1.000 R7748 G1 225.01 N 1 177772202 S272* G C nonsense Het probably null phenotype 11/26/2019
7 597013 UTSW Aga 1.000 R7748 G1 225.01 N 8 53511805 M1L A T start codon destroyed Het possibly damaging 0.785 phenotype 11/26/2019
8 596969 UTSW Anxa5 0.000 R7748 G1 225.01 N 3 36465331 T3M G A missense Het probably damaging 0.973 0.647 phenotype 11/26/2019
9 597020 UTSW Arhgap45 0.000 R7748 G1 225.01 N 10 80016932 A T unclassified Het probably benign 11/26/2019
10 596985 UTSW Atp6v0a2 0.119 R7748 G1 225.01 N 5 124716496 H639L A T missense Het probably benign 0.002 phenotype 11/26/2019
11 597046 UTSW BC005537 0.258 R7748 G1 225.01 N 13 24803399 R7W C T missense Het possibly damaging 0.953 0.702 11/26/2019
12 597048 UTSW Bcl2l2 0.563 R7748 G1 225.01 N 14 54884379 C T start gained Het probably benign phenotype 11/26/2019
13 596981 UTSW Bod1l 0.956 R7748 G1 225.01 N 5 41832340 S347A A C missense Het probably damaging 0.969 11/26/2019
14 597056 UTSW Calcoco1 0.426 R7748 G1 225.01 N 15 102719561 D46G T C missense Het probably damaging 0.999 11/26/2019
15 596996 UTSW Camk1 0.000 R7748 G1 225.01 N 6 113340328 E60G T C missense Het probably damaging 0.961 phenotype 11/26/2019
16 596972 UTSW Capza1 0.497 R7748 G1 225.01 N 3 104825405 A T critical splice donor site 2 bp Het probably null phenotype 11/26/2019
17 596984 UTSW Ccdc18 0.000 R7748 G1 225.01 N 5 108149041 T A critical splice donor site 2 bp Het probably null 11/26/2019
18 596956 UTSW Cdh20 0.192 R7748 G1 225.01 N 1 104941299 A172T G A missense Het probably damaging 1.000 phenotype 11/26/2019
19 597023 UTSW Cdk4 0.932 R7748 G1 225.01 N 10 127064429 A65V C T missense Het possibly damaging 0.779 phenotype 11/26/2019
20 596988 UTSW Cftr 0.222 R7748 G1 225.01 N 6 18277889 T C critical splice donor site 2 bp Het probably null phenotype 11/26/2019
21 597028 UTSW Chd3 0.000 R7748 G1 225.01 N 11 69355633 M1092V T C missense Het probably benign 0.001 phenotype 11/26/2019
22 596967 UTSW Chd6 0.705 R7748 G1 225.01 N 2 160966619 H1558Q A T missense Het probably benign 0.366 phenotype 11/26/2019
23 596957 UTSW Chil1 0.071 R7748 G1 225.01 N 1 134189228 H318R A G missense Het probably benign 0.001 phenotype 11/26/2019
24 596955 UTSW Cps1 1.000 R7748 G1 225.01 N 1 67139806 Y59C A G missense Het probably damaging 1.000 phenotype 11/26/2019
25 597015 UTSW Cyb5r4 0.000 R7748 G1 225.01 N 9 87032381 V111A T C missense Het probably damaging 0.999 phenotype 11/26/2019
26 597008 UTSW D430042O09Rik 0.000 R7748 G1 225.01 N 7 125829801 M558L A T missense Het probably benign 0.004 phenotype 11/26/2019
27 597060 UTSW Ddx39b 0.967 R7748 G1 225.01 N 17 35252750 V291M G A missense Het probably damaging 0.965 phenotype 11/26/2019
28 597062 UTSW Dhx57 0.189 R7748 G1 225.01 N 17 80265117 F709S A G missense Het probably damaging 1.000 11/26/2019
29 596954 UTSW Eef1b2 0.000 R7748 G1 225.01 N 1 63177865 K64N A T missense Het probably damaging 0.986 phenotype 11/26/2019
30 596953 UTSW Fam135a 0.127 R7748 G1 225.01 N 1 24028969 S940P A G missense Het probably benign 0.004 11/26/2019
31 596997 UTSW Fam234b 0.081 R7748 G1 225.01 N 6 135209351 V119E T A missense Het probably damaging 1.000 11/26/2019
32 596999 UTSW Fbxo46 0.089 R7748 G1 225.01 N 7 19136533 C359S G C missense Het probably damaging 0.979 phenotype 11/26/2019
33 596992 UTSW Fkbp14 0.339 R7748 G1 225.01 N 6 54595520 C A unclassified Het probably benign phenotype 11/26/2019
34 596960 UTSW Fmn2 0.837 R7748 G1 208.01 N 1 174666649 V1243E T A missense Het probably damaging 0.999 phenotype 11/26/2019
35 596974 UTSW Fsbp 0.191 R7748 G1 225.01 N 4 11579924 T64K C A missense Het probably damaging 0.999 11/26/2019
36 597039 UTSW Fscb 0.067 R7748 G1 225.01 N 12 64474407 M95K A T missense Het probably benign 0.041 11/26/2019
37 597050 UTSW Fyb 0.000 R7748 G1 225.01 N 15 6638826 V500G T G missense Het probably damaging 1.000 phenotype 11/26/2019
38 597037 UTSW G2e3 0.589 R7748 G1 225.01 N 12 51371667 N615S A G missense Het probably benign 0.001 phenotype 11/26/2019
39 597058 UTSW Gart 1.000 R7748 G1 225.01 N 16 91630652 D486G T C missense Het possibly damaging 0.664 phenotype 11/26/2019
40 597031 UTSW Gas2l2 0.000 R7748 G1 225.01 N 11 83422398 D696V T A missense Het probably benign 0.001 phenotype 11/26/2019
41 596983 UTSW Glmn 1.000 R7748 G1 225.01 N 5 107562244 C T critical splice donor site 1 bp Het probably null phenotype 11/26/2019
42 596958 UTSW Gm47985 0.408 R7748 G1 141.01 N 1 151182974 D122V A T missense Het probably damaging 0.988 11/26/2019
43 597057 UTSW Gm49333 0.107 R7748 G1 225.01 N 16 20633084 D407V A T missense Het probably damaging 0.989 11/26/2019
44 597059 UTSW Gm7168 0.091 R7748 G1 225.01 N 17 13948652 K94E A G missense Het probably benign 0.028 11/26/2019
45 596963 UTSW Gm996 0.083 R7748 G1 225.01 N 2 25578959 E313D T A missense Het possibly damaging 0.455 11/26/2019
46 597017 UTSW Gnai2 0.844 R7748 G1 225.01 N 9 107615735 H323R T C missense Het phenotype 11/26/2019
47 596968 UTSW Helz2 0.000 R7748 G1 225.01 N 2 181234531 R1390H C T missense Het probably damaging 1.000 phenotype 11/26/2019
48 597032 UTSW Igf2bp1 0.289 R7748 G1 225.01 N 11 95967587 M453V T C missense Het probably benign 0.032 phenotype 11/26/2019
49 597044 UTSW Ighv3-1 0.160 R7748 G1 225.01 N 12 113964650 V30M C T missense Het probably damaging 0.978 11/26/2019
50 597010 UTSW Inpp5a 1.000 R7748 G1 225.01 N 7 139574995 R343S A T missense Het probably damaging 0.963 phenotype 11/26/2019
51 596962 UTSW Itga8 0.699 R7748 G1 225.01 N 2 12230239 I403F T A missense Het possibly damaging 0.802 phenotype 11/26/2019
52 597033 UTSW Krt33a 0.060 R7748 G1 225.01 N 11 100011602 R404H C T missense Het probably benign 0.000 phenotype 11/26/2019
53 597034 UTSW Krt34 0.091 R7748 G1 225.01 N 11 100038938 E244V T A missense Het probably damaging 1.000 phenotype 11/26/2019
54 597035 UTSW Krt42 0.075 R7748 G1 225.01 N 11 100266966 E224G T C missense Het probably damaging 1.000 11/26/2019
55 597012 UTSW Krtap5-2 0.082 R7748 G1 217.47 N 7 142175108 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA critical splice acceptor site Het probably benign 11/26/2019
56 597061 UTSW Lama1 1.000 R7748 G1 225.01 N 17 67750590 L553P T C missense Het phenotype 11/26/2019
57 596964 UTSW Lcn9 0.049 R7748 G1 225.01 N 2 25824914 *179K T A makesense Het probably null phenotype 11/26/2019
58 597018 UTSW Lrrc2 0.000 R7748 G1 225.01 N 9 110980931 M345R T G missense Het possibly damaging 0.626 phenotype 11/26/2019
59 597053 UTSW March11 0.276 R7748 G1 225.01 N 15 26387830 V257A T C missense Het probably damaging 0.978 phenotype 11/26/2019
60 596979 UTSW Masp2 0.238 R7748 G1 225.01 N 4 148605706 I224T T C missense Het probably benign 0.001 phenotype 11/26/2019
61 596959 UTSW Mpz 0.121 R7748 G1 225.01 N 1 171159940 A T critical splice acceptor site Het probably null phenotype 11/26/2019
62 597045 UTSW Mtr 1.000 R7748 G1 225.01 N 13 12227839 A442T C T missense Het probably benign 0.001 phenotype 11/26/2019
63 597011 UTSW Muc5b 0.207 R7748 G1 225.01 N 7 141847805 K596R A G missense Het unknown phenotype 11/26/2019
64 597027 UTSW Myo15 0.000 R7748 G1 225.01 N 11 60504901 F1397C T G missense Het phenotype 11/26/2019
65 596986 UTSW Ncor2 1.000 R7748 G1 225.01 N 5 125109967 I173V T C missense Het unknown phenotype 11/26/2019
66 597047 UTSW Ngly1 0.804 R7748 G1 225.01 N 14 16290820 I434K T A missense Het possibly damaging 0.618 phenotype 11/26/2019
67 596971 UTSW Notch2 1.000 R7748 G1 225.01 N 3 98138484 H1655R A G missense Het possibly damaging 0.692 phenotype 11/26/2019
68 597036 UTSW Notum 0.809 R7748 G1 225.01 N 11 120654801 A390T C T missense Het probably damaging 0.989 11/26/2019
69 597030 UTSW Olfr381 0.059 R7748 G1 225.01 N 11 73486168 I219L T G missense Het probably benign 0.025 phenotype 11/26/2019
70 597006 UTSW Olfr519 0.065 R7748 G1 225.01 N 7 108894078 T115A T C missense Het probably benign 0.220 phenotype 11/26/2019
71 596982 UTSW Pds5a 1.000 R7748 G1 225.01 N 5 65619666 I51F T A missense Het possibly damaging 0.933 phenotype 11/26/2019
72 597052 UTSW Pdzd2 0.121 R7748 G1 225.01 N 15 12385786 R966L C A missense Het possibly damaging 0.600 phenotype 11/26/2019
73 596977 UTSW Plk3 0.000 R7748 G1 225.01 N 4 117131728 Y278C T C missense Het probably damaging 1.000 phenotype 11/26/2019
74 596994 UTSW Plxna1 0.910 R7748 G1 225.01 N 6 89337352 C G critical splice acceptor site Het probably null phenotype 11/26/2019
75 596995 UTSW Plxna1 0.910 R7748 G1 225.01 N 6 89337353 T A critical splice acceptor site Het probably null phenotype 11/26/2019
76 597042 UTSW Ppp4r4 0.216 R7748 G1 225.01 N 12 103605061 G A critical splice donor site 1 bp Het probably null phenotype 11/26/2019
77 596965 UTSW Pramel6 0.060 R7748 G1 225.01 N 2 87508699 V81E T A missense Het probably damaging 0.998 11/26/2019
78 596978 UTSW Prdm2 0.000 R7748 G1 225.01 N 4 143135889 E277G T C missense Het possibly damaging 0.891 phenotype 11/26/2019
79 597064 UTSW Prkg1 0.639 R7748 G1 225.01 N 19 30993091 I222F T A missense Het possibly damaging 0.898 phenotype 11/26/2019
80 597001 UTSW Proser3 0.063 R7748 G1 225.01 N 7 30540072 S536T A T missense Het possibly damaging 0.904 11/26/2019
81 596989 UTSW Prrt4 0.083 R7748 G1 225.01 N 6 29177191 G193V C A missense Het probably damaging 1.000 11/26/2019
82 597041 UTSW Ptpn21 0.151 R7748 G1 225.01 N 12 98688772 H645Q A T missense Het probably benign 0.008 phenotype 11/26/2019
83 596976 UTSW Ptprd 0.000 R7748 G1 225.01 N 4 76099504 I744V T C missense Het probably null 0.390 phenotype 11/26/2019
84 597016 UTSW Rad54l2 1.000 R7748 G1 225.01 N 9 106719034 V235A A G missense Het possibly damaging 0.526 phenotype 11/26/2019
85 596991 UTSW Repin1 0.000 R7748 G1 225.01 N 6 48597345 E403* G T nonsense Het probably null 0.965 phenotype 11/26/2019
86 597054 UTSW Rgs22 0.000 R7748 G1 225.01 N 15 36122269 C T critical splice donor site 1 bp Het probably null 11/26/2019
87 597021 UTSW Rtcb 0.969 R7748 G1 225.01 N 10 85941968 D447E A T missense Het probably benign 0.001 phenotype 11/26/2019
88 597040 UTSW Rtn1 0.000 R7748 G1 225.01 N 12 72216926 V744I C T missense Het possibly damaging 0.529 phenotype 11/26/2019
89 597038 UTSW Scfd1 0.960 R7748 G1 225.01 N 12 51389357 I96M T G missense Het probably benign 0.208 11/26/2019
90 597043 UTSW Serpina3b 0.062 R7748 G1 225.01 N 12 104130463 M1T T C start codon destroyed Het probably null 0.999 11/26/2019
91 597024 UTSW Slc1a4 0.000 R7748 G1 225.01 N 11 20332252 Y74C T C missense Het probably damaging 1.000 phenotype 11/26/2019
92 596973 UTSW Slc9b2 0.000 R7748 G1 225.01 N 3 135326179 I267F A T missense Het possibly damaging 0.899 phenotype 11/26/2019
93 596980 UTSW Sorcs2 0.000 R7748 G1 225.01 N 5 36229175 M173K A T missense Het possibly damaging 0.565 phenotype 11/26/2019
94 597026 UTSW Sparc 0.000 R7748 G1 225.01 N 11 55398600 I226V T C missense Het probably benign 0.007 phenotype 11/26/2019
95 597029 UTSW Spata22 0.000 R7748 G1 225.01 N 11 73336254 I98S T G missense Het probably null 0.994 phenotype 11/26/2019
96 597051 UTSW Spef2 0.100 R7748 G1 225.01 N 15 9652945 V917M C T missense Het probably damaging 0.979 phenotype 11/26/2019
97 596990 UTSW Sspo 0.000 R7748 G1 225.01 N 6 48449465 C139* C A nonsense Het probably null 11/26/2019
98 597003 UTSW Tenm4 1.000 R7748 G1 225.01 N 7 96894702 D2012G A G missense Het probably damaging 0.999 phenotype 11/26/2019
99 596966 UTSW Tgm5 0.300 R7748 G1 225.01 N 2 121052808 R351C G A missense Het probably damaging 1.000 phenotype 11/26/2019
100 597000 UTSW Tmem145 0.101 R7748 G1 225.01 N 7 25307328 W82* G A nonsense Het probably null phenotype 11/26/2019
[records 1 to 100 of 112] next >> last >|