Incidental Mutations

66 incidental mutations are currently displayed, and affect 66 genes.
10 are Possibly Damaging.
24 are Probably Damaging.
27 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 597069 UTSW 4933406M09Rik 0.000 R7749 G1 225.01 N 1 134390512 M341L A T missense Het probably benign 0.452 11/26/2019
2 597130 UTSW Actr1a 0.957 R7749 G1 225.01 N 19 46379747 S254T A T missense Het probably benign 0.025 phenotype 11/26/2019
3 597094 UTSW Adam12 0.207 R7749 G1 96.01 N 7 134224813 A22V G A missense Het unknown phenotype 11/26/2019
4 597110 UTSW Adarb2 0.000 R7749 G1 225.01 N 13 8569739 D87G A G missense Het possibly damaging 0.956 phenotype 11/26/2019
5 597109 UTSW Aldh6a1 0.229 R7749 G1 225.01 N 12 84442081 I59N A T missense Het probably benign 0.003 phenotype 11/26/2019
6 597076 UTSW Ankrd50 0.742 R7749 G1 225.01 N 3 38482721 C161Y C T missense Het probably damaging 1.000 11/26/2019
7 597122 UTSW Anks1 0.000 R7749 G1 225.01 N 17 28038141 I707N T A missense Het probably damaging 0.965 phenotype 11/26/2019
8 597090 UTSW Atoh1 1.000 R7749 G1 225.01 N 6 64729920 M200L A T missense Het possibly damaging 0.889 phenotype 11/26/2019
9 597112 UTSW Bmp1 1.000 R7749 G1 225.01 N 14 70492844 R416H C T missense Het probably damaging 0.999 phenotype 11/26/2019
10 597073 UTSW Caprin1 0.924 R7749 G1 225.01 N 2 103771754 S548P A G missense Het probably benign 0.026 phenotype 11/26/2019
11 597123 UTSW Ccdc167 0.083 R7749 G1 225.01 N 17 29705273 Y63F T A missense Het possibly damaging 0.944 11/26/2019
12 597084 UTSW Cfap99 R7749 G1 225.01 N 5 34307940 D174E T A missense Het probably benign 0.012 11/26/2019
13 597079 UTSW Chil3 0.439 R7749 G1 165.01 N 3 106148845 N331T T G missense Het probably benign 0.220 phenotype 11/26/2019
14 597080 UTSW Chmp5 1.000 R7749 G1 225.01 N 4 40949488 I35N T A missense Het probably damaging 1.000 phenotype 11/26/2019
15 597092 UTSW Cpt1c 0.000 R7749 G1 225.01 N 7 44962265 S537T A T missense Het probably benign 0.163 phenotype 11/26/2019
16 597125 UTSW Dhx57 0.173 R7749 G1 225.01 N 17 80238858 M1366L T A missense Het probably benign 0.035 11/26/2019
17 597103 UTSW Dnah9 0.343 R7749 G1 225.01 N 11 65911830 Y3478F T A missense Het probably damaging 0.999 phenotype 11/26/2019
18 597078 UTSW Efna3 0.000 R7749 G1 225.01 N 3 89316640 Y81H A G missense Het probably damaging 1.000 phenotype 11/26/2019
19 597101 UTSW Eif4enif1 0.466 R7749 G1 225.01 N 11 3242608 V812A T C missense Het probably damaging 0.994 phenotype 11/26/2019
20 597119 UTSW Erg 1.000 R7749 G1 225.01 N 16 95377357 I237N A T missense Het probably benign 0.001 phenotype 11/26/2019
21 597126 UTSW Fem1c 0.000 R7749 G1 225.01 N 18 46524118 N176K G T missense Het probably damaging 1.000 phenotype 11/26/2019
22 597117 UTSW Fgd4 0.000 R7749 G1 225.01 N 16 16475154 Y233C T C missense Het probably benign 0.017 phenotype 11/26/2019
23 597081 UTSW Foxd2 0.422 R7749 G1 113.01 N 4 114907812 A337V G A missense Het unknown phenotype 11/26/2019
24 597105 UTSW Gsdma2 0.062 R7749 G1 225.01 N 11 98657721 L433P T C missense Het unknown 11/26/2019
25 597128 UTSW Hnrnpul2 0.284 R7749 G1 206.01 N 19 8820424 V48A T C missense Het probably benign 0.000 11/26/2019
26 597116 UTSW Hsf1 0.000 R7749 G1 225.01 N 15 76499187 S396T T A missense Het probably benign 0.375 phenotype 11/26/2019
27 597067 UTSW Htr5b 0.000 R7749 G1 225.01 N 1 121527758 N144K G T missense Het probably damaging 0.970 phenotype 11/26/2019
28 597091 UTSW Igkv9-120 0.193 R7749 G1 225.01 N 6 68050188 S29P T C missense Het probably damaging 0.997 11/26/2019
29 597077 UTSW Igsf10 0.195 R7749 G1 225.01 N 3 59329128 N1211Y T A missense Het possibly damaging 0.878 11/26/2019
30 597070 UTSW Kcnh1 0.158 R7749 G1 225.01 N 1 192277139 I334L A C missense Het probably benign 0.000 phenotype 11/26/2019
31 597114 UTSW Laptm4b 0.087 R7749 G1 225.01 N 15 34276200 I158T T C missense Het probably benign 0.206 11/26/2019
32 597095 UTSW Muc5ac 0.000 R7749 G1 182.01 N 7 141809303 G2117A G C missense Het unknown phenotype 11/26/2019
33 597099 UTSW Nav3 0.000 R7749 G1 225.01 N 10 109703352 T2063A T C missense Het probably damaging 0.994 phenotype 11/26/2019
34 597068 UTSW Nckap5 0.000 R7749 G1 225.01 N 1 126024646 S1390P A G missense Het probably damaging 0.999 11/26/2019
35 597104 UTSW Npepps 0.816 R7749 G1 225.01 N 11 97267628 I104L T G missense Het probably benign 0.000 phenotype 11/26/2019
36 597108 UTSW Numb 1.000 R7749 G1 225.01 N 12 83801277 S229P A G missense Het not run phenotype 11/26/2019
37 597072 UTSW Olfr1156 0.156 R7749 G1 225.01 N 2 87949478 H252Y G A missense Het probably damaging 0.999 phenotype 11/26/2019
38 597082 UTSW Olfr1342 0.085 R7749 G1 225.01 N 4 118690228 S75G T C missense Het probably damaging 0.995 phenotype 11/26/2019
39 597129 UTSW Olfr1443 0.052 R7749 G1 225.01 N 19 12680212 I35F A T missense Het probably benign 0.105 phenotype 11/26/2019
40 597089 UTSW Opn1sw 0.059 R7749 G1 225.01 N 6 29380169 I83F T A missense Het probably benign 0.001 phenotype 11/26/2019
41 597085 UTSW Pigg 0.073 R7749 G1 225.01 N 5 108336296 C603G T G missense Het probably benign 0.000 phenotype 11/26/2019
42 597096 UTSW Pkd1l3 0.000 R7749 G1 214.46 N 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign phenotype 11/26/2019
43 597115 UTSW Pkhd1l1 0.000 R7749 G1 225.01 N 15 44527737 H1504N C A missense Het probably benign 0.005 11/26/2019
44 597065 UTSW Plcd4 0.000 R7749 G1 225.01 N 1 74565133 N757D A G missense Het possibly damaging 0.598 phenotype 11/26/2019
45 597102 UTSW Ppia 0.605 R7749 G1 171.01 N 11 6419569 T152A A G missense Het probably benign 0.011 phenotype 11/26/2019
46 597087 UTSW Pxn 1.000 R7749 G1 225.01 N 5 115548516 Y356N T A missense Het probably benign 0.001 phenotype 11/26/2019
47 597098 UTSW Rhoa R7749 G1 225.01 N 9 108336715 C159S G C missense Het probably damaging 0.997 phenotype 11/26/2019
48 597113 UTSW Rictor 1.000 R7749 G1 225.01 N 15 6772154 S441L C T missense Het probably benign 0.272 0.102 phenotype 11/26/2019
49 597088 UTSW Rita1 0.228 R7749 G1 225.01 N 5 120611441 C69Y C T missense Het probably benign 0.235 11/26/2019
50 597124 UTSW Satb1 1.000 R7749 G1 225.01 N 17 51767933 S512P A G missense Het possibly damaging 0.702 phenotype 11/26/2019
51 597106 UTSW Sectm1b 0.066 R7749 G1 225.01 N 11 121054942 I191T A G missense Het possibly damaging 0.915 11/26/2019
52 597127 UTSW Slc22a6 0.056 R7749 G1 225.01 N 19 8621896 K297R A G missense Het possibly damaging 0.480 phenotype 11/26/2019
53 597111 UTSW Snrnp48 0.959 R7749 G1 225.01 N 13 38221287 Y287H T C missense Het probably benign 0.004 11/26/2019
54 597107 UTSW Sntg2 0.108 R7749 G1 225.01 N 12 30226911 C381S A T missense Het probably benign 0.011 phenotype 11/26/2019
55 597121 UTSW Syngap1 1.000 R7749 G1 225.01 N 17 26959964 M649K T A missense Het probably damaging 0.994 phenotype 11/26/2019
56 597075 UTSW Taf4 1.000 R7749 G1 225.01 N 2 179932029 T682M G A missense Het probably damaging 1.000 0.223 phenotype 11/26/2019
57 597100 UTSW Thap2 0.093 R7749 G1 225.01 N 10 115376384 I79V T C missense Het probably damaging 0.987 11/26/2019
58 597118 UTSW Thap7 0.879 R7749 G1 225.01 N 16 17528603 N172S T C missense Het probably benign 0.000 11/26/2019
59 597093 UTSW Ticrr 0.958 R7749 G1 225.01 N 7 79679096 Y661C A G missense Het possibly damaging 0.936 phenotype 11/26/2019
60 597071 UTSW Ttn 1.000 R7749 G1 225.01 N 2 76776315 N18084D T C missense Het probably damaging 0.998 phenotype 11/26/2019
61 597083 UTSW Usp48 0.965 R7749 G1 225.01 N 4 137650417 K1020M A T missense Het probably damaging 0.999 phenotype 11/26/2019
62 597086 UTSW Vmn2r12 0.085 R7749 G1 225.01 N 5 109086054 N764S T C missense Het probably damaging 0.989 11/26/2019
63 597120 UTSW Vmn2r91 0.065 R7749 G1 225.01 N 17 18136278 I736V A G missense Het possibly damaging 0.750 0.179 11/26/2019
64 597074 UTSW Wfdc6b 0.101 R7749 G1 225.01 N 2 164617419 C134S T A missense Het probably damaging 1.000 11/26/2019
65 597066 UTSW Zcchc2 0.203 R7749 G1 225.01 N 1 106018273 D481V A T missense Het probably damaging 1.000 11/26/2019
66 597097 UTSW Zfp949 0.073 R7749 G1 225.01 N 9 88569870 G498R G A missense Het probably damaging 0.997 phenotype 11/26/2019
[records 1 to 66 of 66]