Incidental Mutations

55 incidental mutations are currently displayed, and affect 55 genes.
10 are Possibly Damaging.
18 are Probably Damaging.
21 are Probably Benign.
3 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 597516 UTSW 2700049A03Rik 1.000 R7755 G1 225.01 Y 12 71189413 M1179I G A missense Het probably benign 0.017 0.124 phenotype 11/26/2019
2 597482 UTSW 4930402F06Rik 0.000 R7755 G1 225.01 Y 2 35376337 Y107C T C missense Het probably damaging 1.000 11/26/2019
3 597508 UTSW Aff4 1.000 R7755 G1 225.01 Y 11 53398379 S452P T C missense Het probably damaging 0.967 0.078 phenotype 11/26/2019
4 597491 UTSW Astn2 0.083 R7755 G1 225.01 Y 4 65794558 D615G T C missense Het probably damaging 0.991 0.543 phenotype 11/26/2019
5 597518 UTSW Begain 0.000 R7755 G1 178.01 Y 12 109052876 L215P A G missense Het probably benign 0.013 11/26/2019
6 597479 UTSW Carf 0.000 R7755 G1 225.01 Y 1 60148055 S606T T A missense Het probably benign 0.002 0.090 phenotype 11/26/2019
7 597488 UTSW Cngb3 0.101 R7755 G1 225.01 Y 4 19461684 T522S A T missense Het probably benign 0.007 phenotype 11/26/2019
8 597519 UTSW Ctsll3 0.000 R7755 G1 225.01 Y 13 60800405 F153I A T missense Het probably damaging 0.999 11/26/2019
9 597481 UTSW Cubn 1.000 R7755 G1 225.01 Y 2 13280078 T3509I G A missense Het probably benign 0.112 phenotype 11/26/2019
10 597492 UTSW Dmrta1 0.000 R7755 G1 225.01 Y 4 89691933 S377P T C missense Het probably benign 0.014 0.099 phenotype 11/26/2019
11 597529 UTSW Dnmbp 0.000 R7755 G1 225.01 Y 19 43850086 A659V G A missense Het probably benign 0.000 0.085 phenotype 11/26/2019
12 597494 UTSW Dspp 0.000 R7755 G1 147.46 N 5 104178361 TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG small deletion Het probably benign phenotype 11/26/2019
13 597503 UTSW Dync2h1 1.000 R7755 G1 225.01 Y 9 7015490 D3598G T C missense Het probably benign 0.001 phenotype 11/26/2019
14 597520 UTSW Fam35a 0.092 R7755 G1 225.01 Y 14 34248890 K627E T C missense Het probably damaging 0.990 11/26/2019
15 597512 UTSW Flot2 0.192 R7755 G1 225.01 Y 11 78049513 F29L T C missense Het probably benign 0.002 phenotype 11/26/2019
16 597515 UTSW Hectd1 1.000 R7755 G1 225.01 Y 12 51802220 I367K A T missense Het possibly damaging 0.856 0.915 phenotype 11/26/2019
17 597490 UTSW Ikbkap 1.000 R7755 G1 225.01 Y 4 56774552 N779S T C missense Het possibly damaging 0.796 0.137 phenotype 11/26/2019
18 597486 UTSW Ivl 0.000 R7755 G1 225.01 Y 3 92572010 K249N T A missense Het probably damaging 0.977 phenotype 11/26/2019
19 597477 UTSW Kdelc1 0.440 R7755 G1 225.01 Y 1 44118573 T C unclassified Het probably benign phenotype 11/26/2019
20 597521 UTSW Khnyn 0.108 R7755 G1 225.01 Y 14 55887968 T503A A G missense Het probably damaging 1.000 0.870 phenotype 11/26/2019
21 597496 UTSW Mbd4 0.237 R7755 G1 225.01 Y 6 115844585 I490F T A missense Het probably damaging 0.992 phenotype 11/26/2019
22 597507 UTSW Mlip 0.119 R7755 G1 225.01 Y 9 77229556 T690A T C missense Het probably benign 0.304 0.062 phenotype 11/26/2019
23 597504 UTSW Mmp1a 0.317 R7755 G1 225.01 Y 9 7467004 D227E T A missense Het possibly damaging 0.919 phenotype 11/26/2019
24 597499 UTSW Mrgprf 0.060 R7755 G1 225.01 Y 7 145308643 L314P T C missense Het probably damaging 1.000 11/26/2019
25 597522 UTSW Ndufb9 R7755 G1 225.01 Y 15 58936406 Y80* T G nonsense Het probably null phenotype 11/26/2019
26 597500 UTSW Neto2 0.192 R7755 G1 225.01 Y 8 85669656 R155H C T missense Het probably damaging 0.998 0.551 phenotype 11/26/2019
27 597506 UTSW Npat 1.000 R7755 G1 225.01 Y 9 53559170 N365K T A missense Het possibly damaging 0.922 11/26/2019
28 597480 UTSW Nsl1 0.927 R7755 G1 225.01 Y 1 191063183 V49M G A missense Het probably benign 0.211 phenotype 11/26/2019
29 597501 UTSW Nudt21 1.000 R7755 G1 225.01 Y 8 94022865 Y191F T A missense Het probably benign 0.330 0.093 phenotype 11/26/2019
30 597509 UTSW Olfr225 0.066 R7755 G1 225.01 Y 11 59613641 R226G A G missense Het probably damaging 0.969 0.633 11/26/2019
31 597505 UTSW Olfr921 0.056 R7755 G1 225.01 N 9 38775777 I174S T G missense Het possibly damaging 0.941 phenotype 11/26/2019
32 597485 UTSW Pcdh18 0.000 R7755 G1 225.01 Y 3 49754829 Y679C T C missense Het possibly damaging 0.586 phenotype 11/26/2019
33 597502 UTSW Pkd1l3 0.000 R7755 G1 225.01 Y 8 109630166 D741G A G missense Het possibly damaging 0.845 phenotype 11/26/2019
34 597476 UTSW Pkhd1 0.150 R7755 G1 225.01 Y 1 20547493 D956G T C missense Het probably damaging 0.980 0.075 phenotype 11/26/2019
35 597495 UTSW Pparg 1.000 R7755 G1 225.01 Y 6 115463106 P214S C T missense Het probably damaging 0.999 phenotype 11/26/2019
36 597493 UTSW Ppargc1a 0.791 R7755 G1 225.01 Y 5 51473541 Y582F T A missense Het unknown phenotype 11/26/2019
37 597524 UTSW Prdm9 0.265 R7755 G1 225.01 Y 17 15544964 C518Y C T missense Het probably damaging 1.000 phenotype 11/26/2019
38 597511 UTSW Rangrf 0.195 R7755 G1 225.01 Y 11 68973714 E2V T A missense Het probably damaging 0.972 phenotype 11/26/2019
39 597513 UTSW Rpl19 R7755 G1 225.01 Y 11 98028367 I45T T C missense Het probably benign 0.203 phenotype 11/26/2019
40 597484 UTSW Rtn4rl2 0.576 R7755 G1 219.01 Y 2 84872463 D255G T C missense Het possibly damaging 0.821 phenotype 11/26/2019
41 597498 UTSW Sirt3 0.000 R7755 G1 225.01 Y 7 140878050 D62G T C missense Het phenotype 11/26/2019
42 597528 UTSW Slc22a30 0.082 R7755 G1 225.01 N 19 8336769 T518A T C missense Het probably damaging 1.000 11/26/2019
43 597478 UTSW Slc40a1 1.000 R7755 G1 225.01 Y 1 45911306 T329A T C missense Het probably damaging 0.989 phenotype 11/26/2019
44 597487 UTSW Slc6a17 0.397 R7755 G1 225.01 Y 3 107474355 G470D C T missense Het probably damaging 1.000 phenotype 11/26/2019
45 597517 UTSW Syne2 0.219 R7755 G1 225.01 Y 12 75997407 I3923L A T missense Het probably benign 0.190 0.083 phenotype 11/26/2019
46 597523 UTSW Tiam2 0.000 R7755 G1 225.01 Y 17 3421316 S411L C T missense Het probably benign 0.010 phenotype 11/26/2019
47 597527 UTSW Ticam1 0.000 R7755 G1 225.01 Y 17 56270182 C638R A G missense Het unknown phenotype 11/26/2019
48 597514 UTSW Tnrc6c 0.000 R7755 G1 225.01 Y 11 117758086 T1528A A G missense Het probably benign 0.002 phenotype 11/26/2019
49 597489 UTSW Ufl1 0.905 R7755 G1 225.01 Y 4 25262274 I404T A G missense Het probably benign 0.000 phenotype 11/26/2019
50 597510 UTSW Usp43 0.000 R7755 G1 225.01 Y 11 67891468 S375T A T missense Het possibly damaging 0.945 11/26/2019
51 628361 UTSW Vmn2r88 0.159 R7755 G1 42.01 Y 14 51413046 A72G C G missense Het probably benign 0.003 03/11/2020
52 597525 UTSW Vmn2r91 0.073 R7755 G1 225.01 Y 17 18110049 I532F A T missense Het possibly damaging 0.877 11/26/2019
53 597526 UTSW Vmn2r95 0.104 R7755 G1 225.01 Y 17 18424105 M1T T C start codon destroyed Het probably null 0.988 11/26/2019
54 597483 UTSW Xirp2 0.331 R7755 G1 225.01 Y 2 67515182 V2589A T C missense Het probably benign 0.000 phenotype 11/26/2019
55 597497 UTSW Zfp128 0.136 R7755 G1 225.01 Y 7 12890313 Q203* C T nonsense Het probably null 0.965 11/26/2019
[records 1 to 55 of 55]