Incidental Mutations

60 incidental mutations are currently displayed, and affect 60 genes.
6 are Possibly Damaging.
17 are Probably Damaging.
22 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 60 of 60] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 598693 UTSW 1700006A11Rik 0.076 R7773 G1 225.01 Y 3 124412531 I336T A G missense Het probably benign 0.001 11/26/2019
2 598689 UTSW 4930519P11Rik 0.129 R7773 G1 225.01 Y 2 154613187 Y84C T C missense Het unknown 11/26/2019
3 598686 UTSW 4930568D16Rik 0.100 R7773 G1 225.01 Y 2 35354594 G249S C T missense Het probably damaging 1.000 11/26/2019
4 598729 UTSW 4933425L06Rik 0.000 R7773 G1 225.01 Y 13 105082285 I42M A G missense Het probably damaging 0.999 phenotype 11/26/2019
5 598714 UTSW Adprhl1 0.000 R7773 G1 225.01 Y 8 13248682 V83I C T missense Het probably damaging 0.999 phenotype 11/26/2019
6 598711 UTSW Agbl1 0.000 R7773 G1 225.01 Y 7 76698837 V894E T A missense Het unknown phenotype 11/26/2019
7 598720 UTSW Amigo3 0.000 R7773 G1 225.01 Y 9 108054668 L430P T C missense Het probably benign 0.007 11/26/2019
8 598704 UTSW Aoc1 0.000 R7773 G1 225.01 Y 6 48906212 I341V A G missense Het probably benign 0.003 0.090 phenotype 11/26/2019
9 598698 UTSW Bod1l 0.953 R7773 G1 225.01 Y 5 41832712 S223P A G missense Het probably benign 0.140 11/26/2019
10 598732 UTSW Cacnb3 0.532 R7773 G1 225.01 Y 15 98639938 T C critical splice donor site 2 bp Het probably null phenotype 11/26/2019
11 598702 UTSW Ccdc63 0.092 R7773 G1 225.01 Y 5 122109272 N503K G T missense Het probably damaging 1.000 11/26/2019
12 598712 UTSW Ccdc83 0.000 R7773 G1 225.01 Y 7 90229912 I225F T A missense Het probably damaging 0.996 11/26/2019
13 598735 UTSW Cd200r1 0.060 R7773 G1 225.01 Y 16 44789687 T90A A G missense Het possibly damaging 0.688 0.135 phenotype 11/26/2019
14 598707 UTSW Cd8a 0.082 R7773 G1 225.01 Y 6 71373815 N88S A G missense Het probably benign 0.010 phenotype 11/26/2019
15 598684 UTSW Cep170 0.569 R7773 G1 225.01 Y 1 176740076 V152A A G missense Het phenotype 11/26/2019
16 598713 UTSW Chid1 0.067 R7773 G1 225.01 Y 7 141529605 M123V T C missense Het probably benign 0.019 11/26/2019
17 598679 UTSW Cnnm4 0.211 R7773 G1 225.01 Y 1 36499522 V595A T C missense Het probably benign 0.000 phenotype 11/26/2019
18 598734 UTSW Coro7 0.076 R7773 G1 225.01 Y 16 4632006 L630P A G missense Het probably damaging 1.000 phenotype 11/26/2019
19 598705 UTSW Cpvl 0.084 R7773 G1 225.01 Y 6 53931905 A G critical splice donor site 2 bp Het probably null phenotype 11/26/2019
20 598683 UTSW Edem3 0.413 R7773 G1 225.01 Y 1 151811596 K762* A T nonsense Het probably null 0.976 phenotype 11/26/2019
21 628427 UTSW Elp6 0.930 R7773 G1 225.01 Y 9 110312559 T A splice site Het probably null 04/06/2020
22 598690 UTSW Emilin3 0.000 R7773 G1 225.01 Y 2 160910798 Y77* A T nonsense Het probably null 11/26/2019
23 598709 UTSW Fam234b 0.079 R7773 G1 225.01 Y 6 135243914 I641N T A missense Het probably benign 0.013 11/26/2019
24 598717 UTSW Farsa 1.000 R7773 G1 225.01 Y 8 84864152 T C critical splice donor site 2 bp Het probably null phenotype 11/26/2019
25 598725 UTSW Foxf2 1.000 R7773 G1 225.01 Y 13 31627199 S374P T C missense Het probably benign 0.004 0.057 phenotype 11/26/2019
26 598722 UTSW Gm11596 0.110 R7773 G1 225.01 N 11 99792841 I151N A T missense Het unknown 11/26/2019
27 598697 UTSW Gm13178 0.051 R7773 G1 225.01 Y 4 144703477 L314Q A T missense Het probably damaging 0.981 11/26/2019
28 598696 UTSW Gm853 0.107 R7773 G1 225.01 Y 4 130220376 N83D T C missense Het probably damaging 0.999 11/26/2019
29 598726 UTSW Gm9817 R7773 G1 225.01 N 13 45078951 Q77* C T nonsense Het probably null 11/26/2019
30 598692 UTSW Gon4l 0.736 R7773 G1 140.01 N 3 88895795 K1238E A G missense Het probably benign 0.002 phenotype 11/26/2019
31 598688 UTSW H13 1.000 R7773 G1 225.01 Y 2 152695511 Y292C A G missense Het probably damaging 0.998 phenotype 11/26/2019
32 598703 UTSW Hip1r 0.000 R7773 G1 225.01 Y 5 124001441 N928S A G missense Het probably benign 0.001 phenotype 11/26/2019
33 598719 UTSW Iqcf4 0.049 R7773 G1 225.01 Y 9 106568613 N112D T C missense Het probably benign 0.084 11/26/2019
34 598716 UTSW Jak3 0.812 R7773 G1 225.01 Y 8 71679042 T125P A C missense Het probably benign 0.000 phenotype 11/26/2019
35 598733 UTSW Krt7 0.000 R7773 G1 225.01 Y 15 101414032 K124Q A C missense Het possibly damaging 0.492 phenotype 11/26/2019
36 598700 UTSW Lrrc66 0.058 R7773 G1 225.01 Y 5 73607321 S793F G A missense Het probably damaging 0.976 11/26/2019
37 598731 UTSW Mycbp2 1.000 R7773 G1 225.01 Y 14 103248404 V1074I C T missense Het probably damaging 0.969 0.097 phenotype 11/26/2019
38 598682 UTSW Nckap5 0.000 R7773 G1 225.01 Y 1 126026844 D657G T C missense Het probably benign 0.001 0.090 11/26/2019
39 598687 UTSW Olfr1053 0.084 R7773 G1 225.01 Y 2 86314690 I199V T C missense Het probably benign 0.014 phenotype 11/26/2019
40 598736 UTSW Olfr1467 0.112 R7773 G1 225.01 Y 19 13365234 V202E T A missense Het probably benign 0.070 phenotype 11/26/2019
41 598721 UTSW Osbpl7 0.205 R7773 G1 225.01 Y 11 97050722 S24G A G missense Het probably benign 0.000 0.090 phenotype 11/26/2019
42 598715 UTSW Pcm1 0.000 R7773 G1 225.01 Y 8 41309573 E1385* G T nonsense Het probably null phenotype 11/26/2019
43 598728 UTSW Poc5 0.000 R7773 G1 225.01 Y 13 96410635 T469A A G missense Het probably damaging 1.000 11/26/2019
44 598694 UTSW Ppp3ca 0.000 R7773 G1 225.01 Y 3 136890461 T296A A G missense Het probably benign 0.000 phenotype 11/26/2019
45 598724 UTSW Prl6a1 0.070 R7773 G1 225.01 Y 13 27318142 I164T T C missense Het probably damaging 1.000 0.647 11/26/2019
46 598730 UTSW Psmd6 0.969 R7773 G1 157.46 Y 14 14119882 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC frame shift Het probably null phenotype 11/26/2019
47 598681 UTSW Rnf149 0.104 R7773 G1 225.01 Y 1 39565218 M188R A C missense Het possibly damaging 0.784 11/26/2019
48 598723 UTSW Rpl10l 0.413 R7773 G1 225.01 Y 12 66284267 I31V T C missense Het probably benign 0.183 0.126 phenotype 11/26/2019
49 598727 UTSW Serinc5 0.106 R7773 G1 225.01 Y 13 92661084 S32P T C missense Het probably damaging 1.000 11/26/2019
50 628428 UTSW Sirt1 1.000 R7773 G1 225.01 Y 10 63326783 K137M T A missense Het possibly damaging 0.753 0.179 phenotype 04/06/2020
51 598691 UTSW Smc4 0.970 R7773 G1 225.01 Y 3 69016163 Y251C A G missense Het probably damaging 1.000 phenotype 11/26/2019
52 598699 UTSW Sod3 0.000 R7773 G1 225.01 Y 5 52368301 E114A A C missense Het possibly damaging 0.944 phenotype 11/26/2019
53 598701 UTSW Tgfbr3 1.000 R7773 G1 225.01 Y 5 107140502 V431A A G missense Het probably benign 0.005 phenotype 11/26/2019
54 598695 UTSW Tlr4 0.000 R7773 G1 225.01 Y 4 66839599 S210P T C missense Het probably damaging 1.000 phenotype 11/26/2019
55 598685 UTSW Trub2 1.000 R7773 G1 225.01 Y 2 29786508 T70N G T missense Het probably benign 0.008 phenotype 11/26/2019
56 598680 UTSW Tsga10 0.085 R7773 G1 225.01 Y 1 37835242 C159S A T missense Het unknown 11/26/2019
57 598706 UTSW Vmn1r15 0.148 R7773 G1 225.01 Y 6 57258659 I171F A T missense Het probably benign 0.052 11/26/2019
58 598710 UTSW Vmn2r50 0.146 R7773 G1 225.01 N 7 10037635 H713L T A missense Het possibly damaging 0.696 11/26/2019
59 598718 UTSW Zcchc14 0.000 R7773 G1 172.01 N 8 121651775 S43G T C missense Het unknown 11/26/2019
60 598708 UTSW Zfp638 0.900 R7773 G1 225.01 Y 6 83979214 I1601T T C missense Het probably damaging 0.999 phenotype 11/26/2019
[records 1 to 60 of 60]