Incidental Mutations

78 incidental mutations are currently displayed, and affect 76 genes.
14 are Possibly Damaging.
29 are Probably Damaging.
29 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 78 of 78] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 600392 UTSW 1700088E04Rik 0.000 R7798 G1 225.01 N 15 79135732 N128I T A missense Het probably damaging 0.972 11/26/2019
2 600349 UTSW 5830473C10Rik 0.067 R7798 G1 225.01 N 5 90597511 S608P T C missense Het possibly damaging 0.720 11/26/2019
3 600375 UTSW Abca13 0.000 R7798 G1 225.01 N 11 9291664 T1176A A G missense Het probably benign 0.038 phenotype 11/26/2019
4 600382 UTSW Abca9 0.000 R7798 G1 225.01 N 11 110138179 V851A A G missense Het probably benign 0.451 phenotype 11/26/2019
5 600358 UTSW Abcc6 0.792 R7798 G1 202.01 N 7 45976853 E1494* C A nonsense Het probably null phenotype 11/26/2019
6 600371 UTSW Adamts14 0.000 R7798 G1 225.01 N 10 61271173 V56E A T missense Het probably damaging 0.988 phenotype 11/26/2019
7 600368 UTSW Adamts15 0.000 R7798 G1 225.01 N 9 30904643 T639M G A missense Het probably damaging 0.999 phenotype 11/26/2019
8 600333 UTSW Arhgap11a 0.000 R7798 G1 225.01 N 2 113843335 V70G A C missense Het probably damaging 0.975 phenotype 11/26/2019
9 600385 UTSW BC051665 0.162 R7798 G1 225.01 N 13 60784435 D113E A T missense Het probably benign 0.064 11/26/2019
10 600400 UTSW Best1 0.000 R7798 G1 225.01 N 19 9991671 Y227C T C missense Het probably damaging 1.000 phenotype 11/26/2019
11 600374 UTSW Camk2b 0.191 R7798 G1 202.01 N 11 5978399 S447P A G missense Het probably benign 0.082 phenotype 11/26/2019
12 600376 UTSW Ccdc88a 1.000 R7798 G1 225.01 N 11 29477348 Q1018K C A missense Het probably benign 0.153 phenotype 11/26/2019
13 600345 UTSW Cfap74 0.000 R7798 G1 225.01 N 4 155422622 V180D T A missense Het 11/26/2019
14 600340 UTSW Clca3a1 0.067 R7798 G1 225.01 N 3 144757962 T185S T A missense Het probably damaging 1.000 11/26/2019
15 600341 UTSW Clca3b 0.063 R7798 G1 225.01 N 3 144828130 S495G T C missense Het probably damaging 1.000 11/26/2019
16 600363 UTSW Cyb5r2 0.000 R7798 G1 225.01 N 7 107753948 Y96N A T missense Het possibly damaging 0.928 phenotype 11/26/2019
17 600396 UTSW Cyp21a1 0.660 R7798 G1 225.01 N 17 34804321 K27E T C missense Het probably benign 0.298 phenotype 11/26/2019
18 600394 UTSW Cyp2ab1 0.000 R7798 G1 225.01 N 16 20312416 E321G T C missense Het probably benign 0.039 11/26/2019
19 600326 UTSW Des 0.527 R7798 G1 225.01 N 1 75362359 I228T T C missense Het probably damaging 0.961 phenotype 11/26/2019
20 600370 UTSW Dis3l 0.269 R7798 G1 147.01 N 9 64341017 P39T G T missense Het probably benign 0.000 phenotype 11/26/2019
21 600334 UTSW Disp2 0.877 R7798 G1 225.01 N 2 118791879 I1031L A C missense Het probably benign 0.000 phenotype 11/26/2019
22 600335 UTSW Ell3 R7798 G1 217.47 N 2 121439456 TCTCCTC TCTC utr 3 prime Het probably benign 11/26/2019
23 600328 UTSW Etl4 0.631 R7798 G1 225.01 N 2 20781946 G A critical splice donor site 1 bp Het probably null phenotype 11/26/2019
24 600356 UTSW Fgf23 1.000 R7798 G1 225.01 N 6 127073214 D62V A T missense Het probably damaging 1.000 phenotype 11/26/2019
25 600388 UTSW Galnt15 0.060 R7798 G1 225.01 N 14 32029905 T138I C T missense Het possibly damaging 0.524 11/26/2019
26 600380 UTSW Ggt6 0.000 R7798 G1 143.01 N 11 72435541 A T start gained Het probably benign phenotype 11/26/2019
27 600346 UTSW Gm28710 0.248 R7798 G1 225.01 N 5 16856658 F801L T C missense Het possibly damaging 0.845 11/26/2019
28 600397 UTSW Gm9573 0.097 R7798 G1 100.01 N 17 35621254 G680A C G missense Het unknown 11/26/2019
29 600390 UTSW Gpr180 0.193 R7798 G1 225.01 N 14 118153686 V209D T A missense Het probably damaging 1.000 phenotype 11/26/2019
30 600386 UTSW Gzma 0.106 R7798 G1 225.01 N 13 113096324 F78Y A T missense Het probably benign 0.063 phenotype 11/26/2019
31 600354 UTSW Igkv8-30 0.214 R7798 G1 225.01 N 6 70117371 C19S A T missense Het probably benign 0.007 11/26/2019
32 600325 UTSW Il1r1 0.083 R7798 G1 225.01 N 1 40310366 V361I G A missense Het probably benign 0.000 phenotype 11/26/2019
33 600338 UTSW Intu 1.000 R7798 G1 225.01 N 3 40691929 V598A T C missense Het probably damaging 0.997 phenotype 11/26/2019
34 600357 UTSW Itpr2 0.000 R7798 G1 225.01 N 6 146386015 F471L A G missense Het probably benign 0.057 phenotype 11/26/2019
35 600350 UTSW Kntc1 0.955 R7798 G1 225.01 N 5 123786294 V1081E T A missense Het probably benign 0.000 phenotype 11/26/2019
36 600351 UTSW Kntc1 0.955 R7798 G1 225.01 N 5 123819117 V2163E T A missense Het possibly damaging 0.938 phenotype 11/26/2019
37 600343 UTSW Macf1 1.000 R7798 G1 225.01 N 4 123378100 K6552E T C missense Het probably damaging 0.999 phenotype 11/26/2019
38 600393 UTSW Marf1 0.179 R7798 G1 225.01 N 16 14138451 H842R T C missense Het probably benign 0.001 phenotype 11/26/2019
39 600378 UTSW Mgat4b 0.000 R7798 G1 139.01 N 11 50225670 T10A A G missense Het possibly damaging 0.907 phenotype 11/26/2019
40 600365 UTSW Muc5ac 0.000 R7798 G1 225.01 N 7 141794041 T C critical splice donor site 2 bp Het probably null phenotype 11/26/2019
41 600402 UTSW Nrk 0.185 R7798 G1 104.47 N X 138982677 CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 11/26/2019
42 600342 UTSW Nsun4 0.372 R7798 G1 225.01 N 4 116051174 S730R T G missense Het possibly damaging 0.827 11/26/2019
43 600331 UTSW Olfr1112 0.061 R7798 G1 225.01 N 2 87192292 I202L A T missense Het probably benign 0.003 phenotype 11/26/2019
44 600332 UTSW Olfr1310 0.376 R7798 G1 209.01 N 2 112008272 F305L A G missense Het probably benign 0.000 phenotype 11/26/2019
45 600329 UTSW Olfr351 0.100 R7798 G1 225.01 N 2 36860336 E4G T C missense Het probably benign 0.015 phenotype 11/26/2019
46 600330 UTSW Olfr360 0.061 R7798 G1 225.01 N 2 37069174 S290C A T missense Het probably damaging 1.000 phenotype 11/26/2019
47 600389 UTSW Olfr727 0.078 R7798 G1 225.01 N 14 50127438 Y287F A T missense Het probably damaging 0.997 phenotype 11/26/2019
48 600344 UTSW Padi3 0.000 R7798 G1 225.01 N 4 140786439 E653K C T missense Het probably benign 0.000 phenotype 11/26/2019
49 600367 UTSW Pde4a 0.243 R7798 G1 225.01 N 9 21198663 E280G A G missense Het possibly damaging 0.627 phenotype 11/26/2019
50 600336 UTSW Phactr3 0.129 R7798 G1 225.01 N 2 178283910 R326H G A missense Het probably benign 0.187 phenotype 11/26/2019
51 600399 UTSW Prob1 0.214 R7798 G1 225.01 N 18 35653344 P619L G A missense Het possibly damaging 0.930 11/26/2019
52 600391 UTSW Ptk2 1.000 R7798 G1 225.01 N 15 73295375 R368W G A missense Het probably damaging 1.000 phenotype 11/26/2019
53 600383 UTSW Rgs6 0.234 R7798 G1 225.01 N 12 83069519 T240A A G missense Het probably benign 0.021 phenotype 11/26/2019
54 600381 UTSW Rpa1 1.000 R7798 G1 225.01 N 11 75312809 Y356N A T missense Het probably damaging 0.958 phenotype 11/26/2019
55 600395 UTSW Rxrb 0.884 R7798 G1 225.01 N 17 34033605 D165E T A missense Het probably damaging 0.998 phenotype 11/26/2019
56 600379 UTSW Sco1 1.000 R7798 G1 225.01 N 11 67053802 T84A A G missense Het possibly damaging 0.673 phenotype 11/26/2019
57 600347 UTSW Sepsecs 0.965 R7798 G1 225.01 N 5 52647189 I380V T C missense Het probably benign 0.000 phenotype 11/26/2019
58 600387 UTSW Sfmbt1 0.708 R7798 G1 225.01 N 14 30816802 W793R T A missense Het probably damaging 1.000 phenotype 11/26/2019
59 600360 UTSW Slco3a1 0.208 R7798 G1 225.01 N 7 74318596 S459P A G missense Het probably benign 0.003 11/26/2019
60 600364 UTSW Smg1 1.000 R7798 G1 225.01 N 7 118171939 S1503R A T missense Het possibly damaging 0.734 phenotype 11/26/2019
61 600337 UTSW Sox2 1.000 R7798 G1 225.01 N 3 34650642 R76H G A missense Het probably damaging 0.957 phenotype 11/26/2019
62 600359 UTSW Spty2d1 0.912 R7798 G1 225.01 N 7 46996056 S613F G A missense Het probably damaging 1.000 11/26/2019
63 600373 UTSW Stab2 0.000 R7798 G1 225.01 N 10 86957912 Y440N A T missense Het probably damaging 0.983 phenotype 11/26/2019
64 600372 UTSW Syn3 0.000 R7798 G1 225.01 N 10 86080253 Y290H A G missense Het probably damaging 0.998 phenotype 11/26/2019
65 600366 UTSW Tex15 0.541 R7798 G1 225.01 N 8 33581847 S2474F C T missense Het possibly damaging 0.691 phenotype 11/26/2019
66 600377 UTSW Tgtp1 0.130 R7798 G1 225.01 N 11 48987332 F182S A G missense Het probably benign 0.000 0.090 11/26/2019
67 600355 UTSW Tmcc1 0.308 R7798 G1 225.01 N 6 116043578 S304R A T missense Het 11/26/2019
68 600353 UTSW Tmem130 0.058 R7798 G1 225.01 N 5 144743770 K275Q T G missense Het probably damaging 0.999 11/26/2019
69 600327 UTSW Tmem9 0.104 R7798 G1 225.01 N 1 136034189 T174K C A missense Het probably damaging 0.975 11/26/2019
70 600352 UTSW Ttyh3 0.135 R7798 G1 225.01 N 5 140634783 R233Q C T missense Het probably damaging 1.000 phenotype 11/26/2019
71 600401 UTSW Twnk 1.000 R7798 G1 225.01 N 19 45007668 M180T T C missense Het probably benign 0.005 phenotype 11/26/2019
72 600369 UTSW Ube4a 0.000 R7798 G1 225.01 N 9 44933331 V874A A G missense Het probably damaging 1.000 phenotype 11/26/2019
73 600348 UTSW Ugt2a3 0.089 R7798 G1 225.01 N 5 87327723 N350S T C missense Het probably damaging 1.000 11/26/2019
74 600398 UTSW Vegfa 1.000 R7798 G1 225.01 N 17 46031835 G19D C T missense Het probably damaging 1.000 phenotype 11/26/2019
75 600339 UTSW Vmn2r2 0.085 R7798 G1 225.01 N 3 64134097 C399F C A missense Het possibly damaging 0.601 11/26/2019
76 600361 UTSW Vmn2r65 0.077 R7798 G1 225.01 N 7 84946322 P385T G T missense Het probably benign 0.003 11/26/2019
77 600362 UTSW Vmn2r65 0.077 R7798 G1 225.01 N 7 84946984 F164S A G missense Het probably damaging 1.000 11/26/2019
78 600384 UTSW Zcchc6 0.666 R7798 G1 225.01 N 13 59815575 M323K A T missense Het possibly damaging 0.811 11/26/2019
[records 1 to 78 of 78]