Incidental Mutations

38 incidental mutations are currently displayed, and affect 38 genes.
6 are Possibly Damaging.
8 are Probably Damaging.
16 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 38 of 38] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 600557 UTSW 1700007K13Rik 0.060 R7802 G1 130.47 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 11/26/2019
2 600559 UTSW Abl1 0.942 R7802 G1 225.01 Y 2 31760426 V12A T C missense Het probably benign 0.000 0.085 phenotype 11/26/2019
3 600579 UTSW Bahcc1 0.891 R7802 G1 225.01 Y 11 120274692 F983S T C missense Het probably benign 0.029 phenotype 11/26/2019
4 600564 UTSW Cecr2 1.000 R7802 G1 225.01 Y 6 120743847 I312T T C missense Het probably benign 0.452 phenotype 11/26/2019
5 600575 UTSW Col6a2 0.000 R7802 G1 225.01 Y 10 76603798 W711R A T missense Het probably damaging 1.000 phenotype 11/26/2019
6 600588 UTSW Epb41l4a 0.000 R7802 G1 225.01 Y 18 33828174 F436L A G missense Het probably benign 0.194 0.208 phenotype 11/26/2019
7 600563 UTSW Epha1 0.124 R7802 G1 225.01 Y 6 42361941 R641Q C T missense Het possibly damaging 0.879 0.193 phenotype 11/26/2019
8 600584 UTSW Ercc6 0.511 R7802 G1 225.01 Y 14 32517303 A116E C A missense Het probably damaging 1.000 0.647 phenotype 11/26/2019
9 600587 UTSW Ermard 0.196 R7802 G1 225.01 Y 17 15061161 E611G A G missense Het probably benign 0.000 phenotype 11/26/2019
10 600581 UTSW Galnt16 0.106 R7802 G1 225.01 Y 12 80581247 I239S T G missense Het probably damaging 1.000 0.698 11/26/2019
11 600576 UTSW Gna15 0.224 R7802 G1 225.01 Y 10 81514341 R76G T C missense Het probably benign 0.283 phenotype 11/26/2019
12 600567 UTSW Herc2 0.944 R7802 G1 225.01 Y 7 56164090 Y2657C A G missense Het probably damaging 1.000 0.481 phenotype 11/26/2019
13 600555 UTSW Mapkapk2 0.000 R7802 G1 225.01 Y 1 131056902 I238V T C missense Het possibly damaging 0.512 0.070 phenotype 11/26/2019
14 600562 UTSW Med13l 0.956 R7802 G1 225.01 Y 5 118728590 S570P T C missense Het probably benign 0.034 0.069 phenotype 11/26/2019
15 600585 UTSW Mettl7a1 0.171 R7802 G1 225.01 N 15 100305301 N152I A T missense Het possibly damaging 0.802 11/26/2019
16 600586 UTSW Mrap 0.080 R7802 G1 225.01 Y 16 90749359 T112M C T missense Het probably benign 0.014 0.085 phenotype 11/26/2019
17 600570 UTSW Nadsyn1 0.000 R7802 G1 225.01 Y 7 143806026 Q403R T C missense Het probably benign 0.000 0.074 phenotype 11/26/2019
18 600560 UTSW Nostrin 0.220 R7802 G1 225.01 Y 2 69189012 V467A T C missense Het probably benign 0.183 phenotype 11/26/2019
19 628597 UTSW Palb2 1.000 R7802 G1 225.01 Y 7 122110896 A T splice site Het probably null 0.976 phenotype 05/18/2020
20 600572 UTSW Parp16 0.000 R7802 G1 225.01 Y 9 65229897 N135S A G missense Het probably benign 0.021 11/26/2019
21 628599 UTSW Pcnt 1.000 R7802 G1 225.01 Y 10 76375303 A T splice site Het probably null phenotype 05/18/2020
22 600583 UTSW Pde8b 0.131 R7802 G1 225.01 Y 13 95100938 D116G T C missense Het probably damaging 0.991 0.124 phenotype 11/26/2019
23 600578 UTSW Psmc5 0.965 R7802 G1 225.01 Y 11 106261712 T C critical splice donor site 2 bp Het probably null phenotype 11/26/2019
24 600568 UTSW Rsf1 1.000 R7802 G1 225.01 Y 7 97661772 V570F G T missense Het 0.087 phenotype 11/26/2019
25 600577 UTSW Rundc3a 0.112 R7802 G1 214.01 Y 11 102400009 E306G A G missense Het probably benign 0.184 11/26/2019
26 600582 UTSW Serpinb6b 0.097 R7802 G1 225.01 N 13 32971596 C T Het 11/26/2019
27 600558 UTSW Setx 0.000 R7802 G1 225.01 Y 2 29147021 T1173A A G missense Het probably benign 0.021 phenotype 11/26/2019
28 600556 UTSW Slamf8 0.000 R7802 G1 225.01 Y 1 172588110 S54P A G missense Het probably damaging 0.992 phenotype 11/26/2019
29 600569 UTSW Slc5a2 0.000 R7802 G1 225.01 Y 7 128271798 D570A A C missense Het possibly damaging 0.798 0.098 phenotype 11/26/2019
30 600554 UTSW Slco5a1 0.121 R7802 G1 225.01 Y 1 12990476 Q7L T A missense Het possibly damaging 0.759 0.077 phenotype 11/26/2019
31 600573 UTSW Stt3b 0.872 R7802 G1 225.01 Y 9 115276881 S175R G T missense Het probably damaging 1.000 phenotype 11/26/2019
32 600574 UTSW Taar6 0.181 R7802 G1 225.01 Y 10 23985253 I132F T A missense Het probably benign 0.018 phenotype 11/26/2019
33 600571 UTSW Tenm3 0.578 R7802 G1 225.01 Y 8 48236465 V2029A A G missense Het probably damaging 0.999 phenotype 11/26/2019
34 628598 UTSW Tgm4 0.065 R7802 G1 225.01 Y 9 123051336 A G intron Het probably benign phenotype 05/18/2020
35 600580 UTSW Togaram1 0.903 R7802 G1 225.01 Y 12 64966984 C336* T A nonsense Het probably null 0.975 11/26/2019
36 600561 UTSW Ttn 1.000 R7802 G1 225.01 Y 2 76937671 T3028M G A missense Het unknown phenotype 11/26/2019
37 600565 UTSW Vmn2r25 0.092 R7802 G1 210.01 Y 6 123851832 I161N A T missense Het possibly damaging 0.879 0.179 11/26/2019
38 600566 UTSW Vwf 0.160 R7802 G1 225.01 Y 6 125666677 C2394R T C missense Het 0.730 phenotype 11/26/2019
[records 1 to 38 of 38]