Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
7 are Possibly Damaging.
18 are Probably Damaging.
21 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 601814 UTSW 4933405O20Rik 0.190 R7820 G1 225.01 Y 7 50599623 I135N T A missense Het probably benign 0.000 12/03/2019
2 601817 UTSW Abca14 0.000 R7820 G1 225.01 Y 7 120212721 N175I A T missense Het probably benign 0.416 12/03/2019
3 601819 UTSW Adam12 0.310 R7820 G1 225.01 Y 7 133998188 V99A A G missense Het probably benign 0.001 phenotype 12/03/2019
4 601830 UTSW Ankfn1 0.211 R7820 G1 225.01 Y 11 89421130 P730T G T missense Het probably damaging 0.992 phenotype 12/03/2019
5 601797 UTSW Arhgap21 0.342 R7820 G1 225.01 Y 2 20863172 S847P A G missense Het probably damaging 0.999 0.141 phenotype 12/03/2019
6 601840 UTSW Cacna1i 0.000 R7820 G1 225.01 Y 15 80372372 A989V C T missense Het probably benign 0.005 phenotype 12/03/2019
7 601796 UTSW Cacnb2 1.000 R7820 G1 225.01 Y 2 14960666 N152K T A missense Het probably damaging 0.996 0.512 phenotype 12/03/2019
8 601829 UTSW Chd3 0.000 R7820 G1 225.01 Y 11 69353238 Y1334N A T missense Het probably damaging 1.000 phenotype 12/03/2019
9 601803 UTSW Clca4a 0.243 R7820 G1 225.01 Y 3 144960671 D473E A T missense Het probably damaging 1.000 12/03/2019
10 601808 UTSW Crhr2 0.110 R7820 G1 225.01 Y 6 55102779 I191S A C missense Het probably damaging 0.972 phenotype 12/03/2019
11 601818 UTSW E430018J23Rik 0.067 R7820 G1 225.01 Y 7 127391436 W460R A T missense Het possibly damaging 0.838 12/03/2019
12 601827 UTSW Eef1akmt3 0.173 R7820 G1 225.01 Y 10 127033194 Q137R T C missense Het possibly damaging 0.780 12/03/2019
13 601833 UTSW Eml1 0.204 R7820 G1 225.01 Y 12 108515174 I432T T C missense Het possibly damaging 0.805 phenotype 12/03/2019
14 601813 UTSW Fcgbp 0.000 R7820 G1 225.01 N 7 28120359 T2504A A G missense Het probably benign 0.011 12/03/2019
15 601823 UTSW Hmgxb4 0.183 R7820 G1 225.01 Y 8 75000946 E186* G T nonsense Het probably null phenotype 12/03/2019
16 601834 UTSW Ighv16-1 0.063 R7820 G1 225.01 Y 12 114068969 N71S T C missense Het probably benign 0.019 0.085 12/03/2019
17 601831 UTSW Kif2b 0.843 R7820 G1 225.01 Y 11 91577274 V61A A G missense Het probably benign 0.007 12/03/2019
18 601837 UTSW Map1b 1.000 R7820 G1 225.01 Y 13 99431177 G1679R C T missense Het unknown phenotype 12/03/2019
19 601839 UTSW Mast4 0.450 R7820 G1 225.01 Y 13 102754088 S1086L G A missense Het probably damaging 1.000 phenotype 12/03/2019
20 601799 UTSW Mcm8 0.685 R7820 G1 225.01 Y 2 132840772 E724G A G missense Het possibly damaging 0.684 phenotype 12/03/2019
21 601809 UTSW Mfap5 0.118 R7820 G1 225.01 Y 6 122520921 D51E C A missense Het probably damaging 0.989 0.633 phenotype 12/03/2019
22 601825 UTSW Mon1a 0.000 R7820 G1 225.01 Y 9 107901312 L245P T C missense Het probably damaging 0.999 12/03/2019
23 601800 UTSW Mtx1 0.466 R7820 G1 194.01 N 3 89214008 H106Q G T missense Het probably benign 0.094 12/03/2019
24 601838 UTSW Naip1 0.000 R7820 G1 188.01 Y 13 100423070 S1142F G A missense Het probably benign 0.207 0.090 phenotype 12/03/2019
25 601826 UTSW Ngp 0.000 R7820 G1 225.01 Y 9 110420864 T77A A G missense Het probably benign 0.041 12/03/2019
26 601815 UTSW Oca2 0.313 R7820 G1 225.01 Y 7 56331965 I612F A T missense Het probably damaging 0.999 phenotype 12/03/2019
27 601820 UTSW Odf3 0.100 R7820 G1 225.01 Y 7 140849263 T128P A C missense Het probably benign 0.445 phenotype 12/03/2019
28 601798 UTSW Olfr1224-ps1 0.076 R7820 G1 225.01 Y 2 89156248 D309V T A missense Het probably benign 0.078 12/03/2019
29 601824 UTSW Olfr147 0.063 R7820 G1 225.01 Y 9 38403566 I228F A T missense Het probably damaging 1.000 0.517 phenotype 12/03/2019
30 601841 UTSW Olfr96 0.184 R7820 G1 225.01 Y 17 37225895 M257L A T missense Het probably benign 0.002 phenotype 12/03/2019
31 601832 UTSW Otop3 0.082 R7820 G1 225.01 Y 11 115339588 V97D T A missense Het probably damaging 0.994 12/03/2019
32 601801 UTSW Ovgp1 0.000 R7820 G1 225.01 Y 3 105986521 A G unclassified Het probably benign phenotype 12/03/2019
33 601795 UTSW Pdc 0.101 R7820 G1 225.01 Y 1 150333270 I168T T C missense Het probably damaging 1.000 0.791 phenotype 12/03/2019
34 601806 UTSW Peg10 1.000 R7820 G1 197.47 N 6 4756398 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG small deletion Het probably benign phenotype 12/03/2019
35 601816 UTSW Plekha7 0.318 R7820 G1 225.01 Y 7 116237480 F18I A T missense Het probably benign 0.120 phenotype 12/03/2019
36 601802 UTSW Plppr4 1.000 R7820 G1 225.01 Y 3 117321949 I753T A G missense Het possibly damaging 0.876 phenotype 12/03/2019
37 601805 UTSW Pms2 0.349 R7820 G1 225.01 Y 5 143914633 S123A T G missense Het possibly damaging 0.803 phenotype 12/03/2019
38 628752 UTSW Pou4f2 0.000 R7820 G1 55.01 Y 8 78436502 T A start gained Het probably benign phenotype 06/19/2020
39 601836 UTSW Ptch1 1.000 R7820 G1 225.01 Y 13 63523061 L885Q A T missense Het probably damaging 1.000 phenotype 12/03/2019
40 601807 UTSW Repin1 0.000 R7820 G1 225.01 Y 6 48597345 E403* G T nonsense Het probably null phenotype 12/03/2019
41 628754 UTSW Rgs11 0.156 R7820 G1 225.01 Y 17 26205195 T A splice site 6 bp Het probably null phenotype 06/19/2020
42 628753 UTSW Samd3 0.127 R7820 G1 225.01 Y 10 26233518 T A splice site Het probably null 06/19/2020
43 601828 UTSW Slit3 0.883 R7820 G1 225.01 Y 11 35700408 D1349G A G missense Het probably benign 0.227 phenotype 12/03/2019
44 601822 UTSW Sorbs2 0.000 R7820 G1 225.01 Y 8 45796556 Q868L A T missense Het probably null 0.163 phenotype 12/03/2019
45 601804 UTSW Speer4f1 0.076 R7820 G1 225.01 Y 5 17479530 S185R T A missense Het probably damaging 0.997 12/03/2019
46 628755 UTSW Spin2f R7820 G1 40.01 Y X 31254699 K28R A G missense Het probably benign 0.000 06/19/2020
47 601810 UTSW Tas2r125 0.073 R7820 G1 225.01 Y 6 132909878 I76M T G missense Het probably benign 0.021 0.085 12/03/2019
48 601821 UTSW Tex15 0.452 R7820 G1 225.01 Y 8 33575062 I1507F A T missense Het probably damaging 0.978 phenotype 12/03/2019
49 601842 UTSW Tmem2 0.731 R7820 G1 225.01 Y 19 21807461 A436V C T missense Het probably damaging 0.977 12/03/2019
50 601835 UTSW Vmn1r215 0.079 R7820 G1 225.01 Y 13 23076545 I252F A T missense Het probably damaging 0.998 12/03/2019
51 601811 UTSW Vmn1r71 0.058 R7820 G1 225.01 Y 7 10748725 F12S A G missense Het possibly damaging 0.852 12/03/2019
52 601812 UTSW Zfp128 0.113 R7820 G1 225.01 Y 7 12891022 Y439C A G missense Het probably benign 0.002 0.090 12/03/2019
[records 1 to 52 of 52]