Incidental Mutations

77 incidental mutations are currently displayed, and affect 75 genes.
12 are Possibly Damaging.
22 are Probably Damaging.
24 are Probably Benign.
8 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 606289 UTSW 1700016H13Rik 0.000 R7841 G1 225.01 N 5 103654940 K16R T C missense Het possibly damaging 0.955 12/20/2019
2 606323 UTSW 2810408A11Rik 0.058 R7841 G1 225.01 N 11 69899286 F210L A G missense Het probably benign 0.013 12/20/2019
3 606340 UTSW A930017K11Rik 0.000 R7841 G1 225.01 N 17 25948484 Y26* A T nonsense Het probably null 12/20/2019
4 606327 UTSW Adam6a 0.068 R7841 G1 225.01 N 12 113545458 D484Y G T missense Het probably damaging 1.000 12/20/2019
5 606310 UTSW AU019823 0.739 R7841 G1 225.01 N 9 50610416 S68R A C missense Het probably damaging 0.979 12/20/2019
6 606321 UTSW B9d1 0.839 R7841 G1 225.01 N 11 61506366 Y29C A G missense Het possibly damaging 0.900 phenotype 12/20/2019
7 606292 UTSW Cald1 1.000 R7841 G1 225.01 N 6 34745761 F115L T C missense Het unknown phenotype 12/20/2019
8 606303 UTSW Ccnd1 0.923 R7841 G1 225.01 N 7 144937981 M107K A T missense Het probably damaging 1.000 phenotype 12/20/2019
9 606328 UTSW Ccnh 0.960 R7841 G1 225.01 N 13 85189593 A20T G A missense Het probably benign 0.001 phenotype 12/20/2019
10 606312 UTSW Cep162 0.157 R7841 G1 225.01 N 9 87244316 D181G T C missense Het probably benign 0.001 12/20/2019
11 606304 UTSW Cep44 0.803 R7841 G1 217.47 N 8 56540983 AACGC A frame shift Het probably null 12/20/2019
12 606306 UTSW Ces2b 0.053 R7841 G1 225.01 N 8 104835060 D262G A G missense Het probably benign 0.188 12/20/2019
13 606296 UTSW Cic 0.928 R7841 G1 225.01 N 7 25285767 Y1146C A G missense Het probably damaging 1.000 phenotype 12/20/2019
14 606305 UTSW Cmtm1 0.250 R7841 G1 225.01 N 8 104309476 R174C G A missense Het possibly damaging 0.548 12/20/2019
15 606318 UTSW Cobl 0.000 R7841 G1 225.01 N 11 12253324 P1126H G T missense Het probably damaging 1.000 phenotype 12/20/2019
16 606335 UTSW Col14a1 0.000 R7841 G1 225.01 N 15 55382480 M460K T A missense Het unknown phenotype 12/20/2019
17 606276 UTSW Cst11 0.065 R7841 G1 225.01 N 2 148771307 R33W G A missense Het possibly damaging 0.934 phenotype 12/20/2019
18 606311 UTSW Cyp19a1 0.000 R7841 G1 225.01 N 9 54171805 V340E A T missense Het probably benign 0.027 phenotype 12/20/2019
19 606283 UTSW Dbt 1.000 R7841 G1 225.01 N 3 116546097 Q378L A T missense Het possibly damaging 0.850 phenotype 12/20/2019
20 606299 UTSW Dchs1 1.000 R7841 G1 225.01 N 7 105762973 V1312A A G missense Het probably benign 0.000 phenotype 12/20/2019
21 606336 UTSW Eif3l 0.964 R7841 G1 225.01 N 15 79089579 M398T T C missense Het probably benign 0.052 12/20/2019
22 606286 UTSW Faxc 0.107 R7841 G1 225.01 N 4 21958584 H247R A G missense Het probably benign 0.116 12/20/2019
23 606342 UTSW Fbxl17 0.488 R7841 G1 225.01 N 17 63487825 R421G T C missense Het probably damaging 0.999 phenotype 12/20/2019
24 606272 UTSW Fbxo3 0.333 R7841 G1 225.01 N 2 104059992 D450E T A missense Het unknown phenotype 12/20/2019
25 606273 UTSW Fmn1 0.318 R7841 G1 225.01 N 2 113529465 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
26 606277 UTSW Foxs1 0.348 R7841 G1 225.01 N 2 152932987 M49L T A missense Het possibly damaging 0.878 phenotype 12/20/2019
27 606307 UTSW Gucy1a2 0.456 R7841 G1 225.01 N 9 3634766 E270G A G missense Het probably benign 0.027 phenotype 12/20/2019
28 606278 UTSW Helz2 0.000 R7841 G1 225.01 N 2 181232902 D1933G T C missense Het probably damaging 0.997 phenotype 12/20/2019
29 606320 UTSW Hspa4 0.881 R7841 G1 225.01 N 11 53267060 A572V G A missense Het possibly damaging 0.947 phenotype 12/20/2019
30 606291 UTSW Ica1 0.231 R7841 G1 225.01 N 6 8737072 D174V T A missense Het probably damaging 1.000 phenotype 12/20/2019
31 606337 UTSW Igfbp6 0.148 R7841 G1 225.01 N 15 102147917 Q137L A T missense Het possibly damaging 0.897 12/20/2019
32 606266 UTSW Il1r2 0.000 R7841 G1 225.01 N 1 40105468 L105P T C missense Het probably damaging 1.000 phenotype 12/20/2019
33 606268 UTSW Iqca 0.000 R7841 G1 225.01 N 1 90059615 C72S A T missense Het phenotype 12/20/2019
34 606332 UTSW Itgbl1 0.110 R7841 G1 225.01 N 14 123972233 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
35 606280 UTSW Ivl 0.000 R7841 G1 208.01 N 3 92572392 Q122L T A missense Het possibly damaging 0.518 phenotype 12/20/2019
36 606269 UTSW Kdsr 0.819 R7841 G1 225.01 N 1 106743685 E198G T C missense Het probably damaging 1.000 phenotype 12/20/2019
37 606314 UTSW Lama2 0.424 R7841 G1 225.01 N 10 27155533 T1510A T C missense Het probably benign 0.001 phenotype 12/20/2019
38 606325 UTSW Lrrc37a 0.132 R7841 G1 225.01 N 11 103501105 Y1165N A T missense Het probably benign 0.032 12/20/2019
39 606330 UTSW Mycbp2 1.000 R7841 G1 225.01 N 14 103146831 A G critical splice donor site 2 bp Het probably null phenotype 12/20/2019
40 606322 UTSW Myh3 0.499 R7841 G1 225.01 N 11 67098692 E1546G A G missense Het probably damaging 0.997 phenotype 12/20/2019
41 606317 UTSW Nacad 0.000 R7841 G1 225.01 N 11 6601031 V720E A T missense Het probably benign 0.001 12/20/2019
42 606295 UTSW Napa 1.000 R7841 G1 225.01 N 7 16115634 D257G A G missense Het possibly damaging 0.943 phenotype 12/20/2019
43 606267 UTSW Nif3l1 0.381 R7841 G1 225.01 N 1 58447883 V76A T C missense Het probably damaging 1.000 phenotype 12/20/2019
44 606287 UTSW Nphp4 0.208 R7841 G1 89.01 N 4 152496683 S108N G A missense Het probably benign 0.015 phenotype 12/20/2019
45 606279 UTSW Npr1 0.129 R7841 G1 225.01 N 3 90454868 L990H A T missense Het probably damaging 1.000 phenotype 12/20/2019
46 606293 UTSW Nup205 0.957 R7841 G1 225.01 N 6 35247437 R322G A G missense Het unknown phenotype 12/20/2019
47 606271 UTSW Olfr1252 0.561 R7841 G1 225.01 N 2 89721965 A49S C A missense Het probably benign 0.064 phenotype 12/20/2019
48 606298 UTSW Olfr668 0.331 R7841 G1 225.01 N 7 104924859 I302F T A missense Het possibly damaging 0.594 phenotype 12/20/2019
49 606329 UTSW Olfr735 0.160 R7841 G1 225.01 N 14 50345828 Q174K G T missense Het probably benign 0.095 phenotype 12/20/2019
50 606308 UTSW Olfr892-ps1 0.168 R7841 G1 225.01 N 9 38190481 M252R T G missense Het unknown 12/20/2019
51 606309 UTSW Olfr897-ps1 R7841 G1 225.01 N 9 38309521 V242E T A missense Het unknown 12/20/2019
52 606300 UTSW Ovch2 0.000 R7841 G1 225.01 N 7 107794091 Q192K G T missense Het probably benign 0.012 12/20/2019
53 606331 UTSW Pcca 1.000 R7841 G1 225.01 N 14 122562972 D91E T A missense Het probably benign 0.033 phenotype 12/20/2019
54 606326 UTSW Pole2 1.000 R7841 G1 225.01 N 12 69204258 T444A T C missense Het probably damaging 1.000 phenotype 12/20/2019
55 606274 UTSW Ppip5k1 0.416 R7841 G1 225.01 N 2 121342795 K466E T C missense Het probably benign 0.127 phenotype 12/20/2019
56 606281 UTSW Ptgfrn 0.000 R7841 G1 225.01 N 3 101060810 I489N A T missense Het probably damaging 0.981 phenotype 12/20/2019
57 606313 UTSW Rassf1 0.157 R7841 G1 225.01 N 9 107561545 *341W A G makesense Het probably null phenotype 12/20/2019
58 606294 UTSW Ret 0.872 R7841 G1 225.01 N 6 118155360 P1040S G A missense Het probably damaging 1.000 phenotype 12/20/2019
59 606333 UTSW Rictor 1.000 R7841 G1 225.01 N 15 6772154 S441L C T missense Het probably benign 0.272 0.102 phenotype 12/20/2019
60 606297 UTSW Rsf1 1.000 R7841 G1 214.46 N 7 97579904 A AAGGCGACGG start codon destroyed Het probably null phenotype 12/20/2019
61 606282 UTSW Slc6a17 0.386 R7841 G1 225.01 N 3 107476898 Y377N A T missense Het possibly damaging 0.690 phenotype 12/20/2019
62 606275 UTSW Snrnp200 1.000 R7841 G1 225.01 N 2 127236834 D1806E C A missense Het probably benign 0.232 phenotype 12/20/2019
63 606338 UTSW Synj2 0.180 R7841 G1 225.01 N 17 6044144 R1215H G A missense Het unknown phenotype 12/20/2019
64 606341 UTSW Tbc1d5 0.000 R7841 G1 217.47 N 17 50799922 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG small deletion Het probably benign 12/20/2019
65 606324 UTSW Top2a 0.969 R7841 G1 225.01 N 11 99022350 D85E A T missense Het probably damaging 1.000 phenotype 12/20/2019
66 606284 UTSW Tram1l1 0.121 R7841 G1 225.01 N 3 124321704 Q171L A T missense Het probably damaging 0.999 12/20/2019
67 606285 UTSW Tram1l1 0.121 R7841 G1 225.01 N 3 124321705 Q171H G T missense Het probably damaging 1.000 12/20/2019
68 606315 UTSW Tspyl4 0.116 R7841 G1 225.01 N 10 34298271 H253R A G missense Het probably damaging 1.000 12/20/2019
69 606270 UTSW Ttn 1.000 R7841 G1 225.01 N 2 76832146 I23V T C missense Het phenotype 12/20/2019
70 606334 UTSW Ubr5 1.000 R7841 G1 225.01 N 15 37980906 N2376D T C missense Het phenotype 12/20/2019
71 606288 UTSW Ugt2b37 0.058 R7841 G1 225.01 N 5 87250630 N316D T C missense Het probably benign 0.045 12/20/2019
72 606301 UTSW Usp31 0.137 R7841 G1 225.01 N 7 121648456 S1255A A C missense Het probably benign 0.001 12/20/2019
73 606302 UTSW Usp31 0.137 R7841 G1 225.01 N 7 121677312 V334E A T missense Het probably damaging 0.964 12/20/2019
74 606339 UTSW Vmn2r108 0.074 R7841 G1 225.01 N 17 20470043 A G critical splice donor site 2 bp Het probably null 12/20/2019
75 606316 UTSW Vmn2r87 0.089 R7841 G1 225.01 N 10 130497226 T52S T A missense Het probably benign 0.306 12/20/2019
76 606319 UTSW Vrk2 0.168 R7841 G1 225.01 N 11 26471457 L500F C A missense Het probably damaging 0.999 phenotype 12/20/2019
77 606290 UTSW Zan 0.083 R7841 G1 225.01 N 5 137436802 I2110F T A missense Het unknown phenotype 12/20/2019
[records 1 to 77 of 77]