Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
9 are Possibly Damaging.
11 are Probably Damaging.
19 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 606546 UTSW 4921509C19Rik 0.000 R7845 G1 224.01 N 2 151472309 H483R T C missense Het probably damaging 0.959 12/20/2019
2 606560 UTSW A430078G23Rik 0.000 R7845 G1 225.01 Y 8 3386959 Y250H T C missense Het probably damaging 0.993 0.247 12/20/2019
3 606575 UTSW Acot2 0.000 R7845 G1 225.01 Y 12 83992988 G424* G T nonsense Het probably null phenotype 12/20/2019
4 606566 UTSW Adat2 0.949 R7845 G1 213.01 Y 10 13552997 G T utr 5 prime Het probably benign 12/20/2019
5 606578 UTSW Bcl2l2 0.737 R7845 G1 225.01 Y 14 54884851 Y157C A G missense Het unknown phenotype 12/20/2019
6 606549 UTSW Bglap2 0.283 R7845 G1 225.01 Y 3 88378694 T A start gained Het probably benign phenotype 12/20/2019
7 606582 UTSW Ccdc14 0.367 R7845 G1 225.01 Y 16 34715364 L495P T C missense Het probably damaging 1.000 12/20/2019
8 606572 UTSW Cobl 0.000 R7845 G1 225.01 Y 11 12365139 D275G T C missense Het probably benign 0.350 phenotype 12/20/2019
9 606562 UTSW Cpne2 0.128 R7845 G1 225.01 Y 8 94551204 N72S A G missense Het probably benign 0.164 phenotype 12/20/2019
10 606559 UTSW D7Ertd443e 0.000 R7845 G1 225.01 Y 7 134270248 F628S A G missense Het probably damaging 1.000 0.248 12/20/2019
11 606543 UTSW Dars2 1.000 R7845 G1 225.01 Y 1 161041748 S644T A T missense Het probably benign 0.005 0.090 phenotype 12/20/2019
12 628667 UTSW Depdc5 1.000 R7845 G1 225.01 Y 5 32903915 A G splice site 4 bp Het probably null phenotype 06/08/2020
13 606576 UTSW Dip2c 0.626 R7845 G1 225.01 N 13 9609044 S860G A G missense Het probably damaging 0.999 phenotype 12/20/2019
14 606579 UTSW Dnajc21 0.206 R7845 G1 225.01 Y 15 10447141 H507P T G missense Het probably damaging 1.000 phenotype 12/20/2019
15 606584 UTSW Eif2ak2 0.551 R7845 G1 225.01 N 17 78863898 Q359K G T missense Het probably damaging 1.000 phenotype 12/20/2019
16 606552 UTSW Epha8 0.000 R7845 G1 225.01 Y 4 136936401 E448G T C missense Het probably benign 0.044 0.086 phenotype 12/20/2019
17 606563 UTSW Exoc3l 0.144 R7845 G1 225.01 Y 8 105290150 S677R G C missense Het probably damaging 0.995 12/20/2019
18 606587 UTSW Fads1 0.000 R7845 G1 225.01 Y 19 10194041 H345Q T A missense Het probably damaging 1.000 phenotype 12/20/2019
19 606581 UTSW Fam118a 0.364 R7845 G1 225.01 Y 15 85045851 D93E T A missense Het possibly damaging 0.937 12/20/2019
20 606542 UTSW Fam135a 0.181 R7845 G1 225.01 Y 1 24029657 I710M T C missense Het probably benign 0.268 12/20/2019
21 606565 UTSW Fbxw14 0.159 R7845 G1 225.01 Y 9 109287603 I13F T A missense Het probably damaging 0.999 12/20/2019
22 606585 UTSW Gemin6 0.878 R7845 G1 225.01 Y 17 80225661 S8G A G missense Het probably benign 0.001 12/20/2019
23 606573 UTSW Ints2 1.000 R7845 G1 225.01 Y 11 86238263 M498K A T missense Het possibly damaging 0.932 phenotype 12/20/2019
24 606556 UTSW Man2a2 0.189 R7845 G1 225.01 Y 7 80368865 A82G G C missense Het probably benign 0.001 0.079 phenotype 12/20/2019
25 606561 UTSW Mast1 0.000 R7845 G1 191.01 Y 8 84925325 E343* C A nonsense Het probably null 0.975 12/20/2019
26 606569 UTSW Micu1 0.581 R7845 G1 225.01 Y 10 59839785 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
27 606574 UTSW Mis18bp1 1.000 R7845 G1 225.01 Y 12 65149328 I554T A G missense Het probably benign 0.010 0.090 12/20/2019
28 606548 UTSW Mrps28 0.570 R7845 G1 225.01 Y 3 8923715 N28Y T A missense Het possibly damaging 0.482 0.171 phenotype 12/20/2019
29 606586 UTSW Mtpap 1.000 R7845 G1 225.01 Y 18 4387134 S395T T A missense Het possibly damaging 0.558 phenotype 12/20/2019
30 606564 UTSW Muc16 0.217 R7845 G1 225.01 Y 9 18640773 H4741Q A T missense Het probably benign 0.015 phenotype 12/20/2019
31 606547 UTSW Ogfr 0.456 R7845 G1 120.46 N 2 180595266 GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG unclassified Het probably benign phenotype 12/20/2019
32 606544 UTSW Olfr1294 0.156 R7845 G1 225.01 Y 2 111538167 G41* C A nonsense Het probably null phenotype 12/20/2019
33 606550 UTSW Olfr1340 0.080 R7845 G1 225.01 Y 4 118726961 M238T T C missense Het probably benign 0.005 phenotype 12/20/2019
34 606557 UTSW Olfr564 0.066 R7845 G1 225.01 N 7 102804285 R269Q G A missense Het not run phenotype 12/20/2019
35 606583 UTSW Ptx4 0.344 R7845 G1 225.01 Y 17 25124954 Y393H T C missense Het possibly damaging 0.948 phenotype 12/20/2019
36 606568 UTSW Ranbp2 1.000 R7845 G1 123.01 Y 10 58447022 V15M G A missense Het probably damaging 0.998 phenotype 12/20/2019
37 606577 UTSW Rbp3 0.739 R7845 G1 225.01 Y 14 33956464 A790S G T missense Het probably benign 0.237 phenotype 12/20/2019
38 606567 UTSW Rfx6 1.000 R7845 G1 225.01 Y 10 51678026 S73T T A missense Het probably benign 0.046 phenotype 12/20/2019
39 606571 UTSW Sec14l3 0.162 R7845 G1 225.01 Y 11 4067972 M84K T A missense Het probably benign 0.380 phenotype 12/20/2019
40 606545 UTSW Sec23b 1.000 R7845 G1 225.01 Y 2 144559396 V59E T A missense Het possibly damaging 0.672 phenotype 12/20/2019
41 606551 UTSW Slc2a1 1.000 R7845 G1 225.01 Y 4 119135928 V425A T C missense Het possibly damaging 0.906 phenotype 12/20/2019
42 606570 UTSW Stab2 0.000 R7845 G1 225.01 Y 10 86996894 V89D A T missense Het probably benign 0.087 phenotype 12/20/2019
43 606553 UTSW Stra8 0.383 R7845 G1 221.01 Y 6 34930964 D117G A G missense Het probably benign 0.231 phenotype 12/20/2019
44 606558 UTSW Syt17 0.000 R7845 G1 225.01 Y 7 118409971 I338N A T missense Het possibly damaging 0.791 12/20/2019
45 606554 UTSW Tas2r136 0.054 R7845 G1 225.01 Y 6 132777870 Y98F T A missense Het probably benign 0.048 phenotype 12/20/2019
46 628668 UTSW Tsks 0.000 R7845 G1 225.01 Y 7 44953744 C A splice site Het probably null 0.976 phenotype 06/08/2020
47 606555 UTSW Wdr62 0.000 R7845 G1 225.01 Y 7 30265242 V359A A G missense Het possibly damaging 0.786 0.150 phenotype 12/20/2019
48 606580 UTSW Xrcc6 0.000 R7845 G1 159.01 Y 15 82016477 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
[records 1 to 48 of 48]