Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
11 are Possibly Damaging.
15 are Probably Damaging.
18 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 606704 UTSW 2300002M23Rik 0.158 R7847 G1 225.01 Y 17 35568652 Y296N T A missense Het probably benign 0.000 phenotype 12/20/2019
2 606701 UTSW Abcc4 0.000 R7847 G1 225.01 Y 14 118627480 E378G T C missense Het probably damaging 0.997 phenotype 12/20/2019
3 606664 UTSW Acp2 0.776 R7847 G1 225.01 Y 2 91210732 H422Y C T missense Het possibly damaging 0.665 phenotype 12/20/2019
4 606672 UTSW Aldoart1 0.927 R7847 G1 225.01 Y 4 72851956 C205Y C T missense Het probably damaging 0.997 0.887 12/20/2019
5 606690 UTSW Alg9 1.000 R7847 G1 225.01 Y 9 50789605 L225S T C missense Het possibly damaging 0.617 phenotype 12/20/2019
6 606667 UTSW Anapc1 1.000 R7847 G1 225.01 Y 2 128669908 V455G A C missense Het possibly damaging 0.926 phenotype 12/20/2019
7 606677 UTSW Arhgef5 0.000 R7847 G1 225.01 Y 6 43275135 S940* C A nonsense Het probably null phenotype 12/20/2019
8 606676 UTSW Asb15 0.000 R7847 G1 225.01 Y 6 24564267 A240E C A missense Het probably damaging 1.000 phenotype 12/20/2019
9 606686 UTSW BB014433 0.081 R7847 G1 217.47 Y 8 15042160 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG small deletion Het probably benign 12/20/2019
10 606673 UTSW Ccdc17 0.069 R7847 G1 225.01 Y 4 116599906 E529G A G missense Het probably benign 0.344 12/20/2019
11 606681 UTSW Cyp2b10 0.119 R7847 G1 225.01 Y 7 25897760 S26P T C missense Het possibly damaging 0.519 phenotype 12/20/2019
12 606678 UTSW Dcp1b 0.115 R7847 G1 225.01 Y 6 119215295 S391P T C missense Het probably benign 0.000 phenotype 12/20/2019
13 606688 UTSW Dock6 0.391 R7847 G1 225.01 Y 9 21801207 L2086Q A T missense Het unknown phenotype 12/20/2019
14 606662 UTSW Ephx1 0.127 R7847 G1 225.01 Y 1 181001861 S41P A G missense Het probably benign 0.001 phenotype 12/20/2019
15 606695 UTSW Erbb3 1.000 R7847 G1 225.01 Y 10 128571189 T1034M G A missense Het probably damaging 1.000 phenotype 12/20/2019
16 606696 UTSW Gm17334 0.188 R7847 G1 225.01 Y 11 53772738 T A intron Het probably benign 12/20/2019
17 606703 UTSW Golgb1 0.849 R7847 G1 225.01 Y 16 36931920 H3227R A G missense Het probably damaging 0.997 phenotype 12/20/2019
18 606698 UTSW Grin2c 0.216 R7847 G1 225.01 Y 11 115260978 P52L G A missense Het possibly damaging 0.675 phenotype 12/20/2019
19 606683 UTSW Herc2 0.927 R7847 G1 225.01 Y 7 56157560 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
20 606700 UTSW Il17rb 0.067 R7847 G1 225.01 Y 14 29996806 Y440H A G missense Het probably damaging 1.000 phenotype 12/20/2019
21 606687 UTSW Kcng4 0.000 R7847 G1 225.01 Y 8 119626142 L343P A G missense Het probably damaging 1.000 phenotype 12/20/2019
22 606665 UTSW Knl1 1.000 R7847 G1 225.01 Y 2 119070976 E1053K G A missense Het probably benign 0.018 phenotype 12/20/2019
23 606706 UTSW Lipo4 0.071 R7847 G1 225.01 Y 19 33514199 V128E A T missense Het possibly damaging 0.946 12/20/2019
24 606685 UTSW Lmntd2 0.071 R7847 G1 225.01 Y 7 141210150 N650D T C missense Het probably benign 0.074 12/20/2019
25 628622 UTSW Lrrfip2 0.177 R7847 G1 225.01 Y 9 111213880 L460P T C missense Het probably damaging 1.000 0.724 05/27/2020
26 606684 UTSW Man2a2 0.240 R7847 G1 225.01 Y 7 80368865 A82G G C missense Het probably benign 0.001 0.079 phenotype 12/20/2019
27 606705 UTSW Mtcl1 0.126 R7847 G1 225.01 Y 17 66344333 Q1379R T C missense Het probably damaging 0.959 phenotype 12/20/2019
28 606692 UTSW Mtfr2 0.112 R7847 G1 225.01 Y 10 20357452 A256T G A missense Het probably benign 0.149 12/20/2019
29 606671 UTSW Mup17 R7847 G1 169.01 N 4 61593219 H159L T A missense Het probably benign 0.195 12/20/2019
30 606666 UTSW Ndufaf1 0.345 R7847 G1 225.01 Y 2 119660053 D175E A T missense Het probably damaging 1.000 0.647 phenotype 12/20/2019
31 606669 UTSW Nup210l 0.351 R7847 G1 225.01 Y 3 90151123 M610V A G missense Het probably benign 0.000 phenotype 12/20/2019
32 606674 UTSW Olfr1338 0.776 R7847 G1 225.01 Y 4 118754368 H59N G T missense Het possibly damaging 0.790 phenotype 12/20/2019
33 606694 UTSW Olfr1354 0.290 R7847 G1 225.01 N 10 78916896 S19T T A missense Het probably benign 0.017 phenotype 12/20/2019
34 606689 UTSW Olfr955 0.116 R7847 G1 225.01 Y 9 39470505 S74P A G missense Het probably benign 0.417 phenotype 12/20/2019
35 606661 UTSW Pard3b 0.000 R7847 G1 225.01 Y 1 62343934 D729G A G missense Het probably benign 0.004 0.085 12/20/2019
36 606699 UTSW Phactr1 0.000 R7847 G1 225.01 Y 13 43057188 L169P T C missense Het possibly damaging 0.956 phenotype 12/20/2019
37 606670 UTSW Rad54b 0.000 R7847 G1 225.01 Y 4 11612655 S762R T A missense Het probably damaging 0.997 0.233 phenotype 12/20/2019
38 606702 UTSW Senp5 0.000 R7847 G1 225.01 Y 16 31990173 V88I C T missense Het probably benign 0.254 phenotype 12/20/2019
39 606693 UTSW Specc1l 0.605 R7847 G1 225.01 Y 10 75309836 V1105A T C missense Het probably damaging 0.989 0.313 phenotype 12/20/2019
40 606660 UTSW Trak2 0.000 R7847 G1 225.01 Y 1 58935818 S72A A C missense Het possibly damaging 0.876 0.171 12/20/2019
41 606697 UTSW Ttyh2 0.078 R7847 G1 203.01 Y 11 114675674 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
42 606663 UTSW Ush2a 0.652 R7847 G1 225.01 Y 1 188430808 C1029Y G A missense Het probably damaging 1.000 phenotype 12/20/2019
43 606675 UTSW Vmn2r17 0.092 R7847 G1 225.01 Y 5 109420197 Y62C A G missense Het probably damaging 0.997 12/20/2019
44 606679 UTSW Vmn2r41 R7847 G1 214.01 N 7 8161548 F2L A G missense Het probably benign 0.011 12/20/2019
45 606691 UTSW Xirp1 0.278 R7847 G1 225.01 Y 9 120019753 D21E G T missense Het possibly damaging 0.915 0.069 phenotype 12/20/2019
46 606680 UTSW Zfp114 0.056 R7847 G1 225.01 Y 7 24181035 Q270K C A missense Het possibly damaging 0.669 12/20/2019
47 606668 UTSW Zfp341 0.000 R7847 G1 225.01 Y 2 154634194 S441P T C missense Het probably damaging 1.000 12/20/2019
48 606682 UTSW Zfp780b 0.069 R7847 G1 225.01 Y 7 27964418 H237Q A C missense Het probably benign 0.001 12/20/2019
[records 1 to 48 of 48]