Incidental Mutations

56 incidental mutations are currently displayed, and affect 56 genes.
13 are Possibly Damaging.
14 are Probably Damaging.
22 are Probably Benign.
5 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 56 of 56] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 607219 UTSW 2700081O15Rik 0.083 R7855 G1 211.01 N 19 7422256 I456N T A missense Het probably damaging 0.998 12/20/2019
2 607200 UTSW Abca6 0.000 R7855 G1 225.01 N 11 110191628 V1173D A T missense Het probably benign 0.009 phenotype 12/20/2019
3 607197 UTSW Ace 1.000 R7855 G1 225.01 N 11 105972379 M327L A T missense Het probably benign 0.049 phenotype 12/20/2019
4 607209 UTSW Bcl2l2 0.709 R7855 G1 225.01 N 14 54884379 C T start gained Het probably benign phenotype 12/20/2019
5 607215 UTSW Bicdl2 0.110 R7855 G1 225.01 N 17 23666017 Q231* C T nonsense Het probably null 12/20/2019
6 607202 UTSW Brms1l 0.935 R7855 G1 225.01 N 12 55866053 D277V A T missense Het possibly damaging 0.905 phenotype 12/20/2019
7 607175 UTSW Cd38 0.000 R7855 G1 225.01 N 5 43901448 L135M C A missense Het probably damaging 1.000 phenotype 12/20/2019
8 607167 UTSW Col6a3 0.000 R7855 G1 225.01 N 1 90810621 P1059T G T missense Het possibly damaging 0.569 phenotype 12/20/2019
9 607176 UTSW Coro1c 0.000 R7855 G1 225.01 N 5 113848597 M262K A T missense Het probably benign 0.207 phenotype 12/20/2019
10 607189 UTSW Cpxm2 0.073 R7855 G1 225.01 N 7 132057695 P481Q G T missense Het possibly damaging 0.564 12/20/2019
11 607208 UTSW Dnah12 0.327 R7855 G1 225.01 N 14 26829329 V2543F G T missense Het probably benign 0.138 12/20/2019
12 607194 UTSW Dock2 0.000 R7855 G1 225.01 N 11 34273698 D1145E A C missense Het probably damaging 0.999 phenotype 12/20/2019
13 607168 UTSW Elf3 0.830 R7855 G1 225.01 N 1 135254352 R364W G A missense Het probably damaging 1.000 phenotype 12/20/2019
14 607178 UTSW Eln 1.000 R7855 G1 135.46 N 5 134711081 AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC utr 3 prime Het probably benign phenotype 12/20/2019
15 607213 UTSW Epha3 0.416 R7855 G1 225.01 N 16 63773560 I55T A G missense Het probably damaging 1.000 phenotype 12/20/2019
16 607218 UTSW Fam69c 0.077 R7855 G1 225.01 N 18 84730046 G A start gained Het probably benign phenotype 12/20/2019
17 607216 UTSW Gfer 0.941 R7855 G1 225.01 N 17 24694285 D198Y C A missense Het probably damaging 1.000 phenotype 12/20/2019
18 607203 UTSW Gm10436 0.111 R7855 G1 225.01 N 12 88176083 I450N A T missense Het probably benign 0.027 12/20/2019
19 607196 UTSW Gm11568 0.074 R7855 G1 225.01 N 11 99858184 T72S A T missense Het unknown 12/20/2019
20 607171 UTSW Gm21994 0.302 R7855 G1 153.01 N 2 150255146 R121Q C T missense Het probably benign 0.002 12/20/2019
21 607164 UTSW Gm5415 0.156 R7855 G1 225.01 N 1 32546033 I265M A C missense Het probably damaging 0.961 12/20/2019
22 607180 UTSW Igkv3-1 0.126 R7855 G1 225.01 N 6 70704069 A84V C T missense Het probably benign 0.232 12/20/2019
23 607165 UTSW Il1rl2 0.000 R7855 G1 225.01 N 1 40343119 Y197S A C missense Het probably damaging 1.000 phenotype 12/20/2019
24 607169 UTSW Il2ra 0.000 R7855 G1 225.01 N 2 11680336 I161T T C missense Het possibly damaging 0.655 phenotype 12/20/2019
25 607204 UTSW Itgb8 1.000 R7855 G1 225.01 N 12 119166772 R667H C T missense Het probably benign 0.000 phenotype 12/20/2019
26 607170 UTSW Kcnh7 0.106 R7855 G1 225.01 N 2 62837194 Q334* G A nonsense Het probably null phenotype 12/20/2019
27 607193 UTSW Lctl 0.112 R7855 G1 225.01 N 9 64133216 R480S A C missense Het possibly damaging 0.893 phenotype 12/20/2019
28 607173 UTSW Lrba 0.000 R7855 G1 225.01 N 3 86315430 I617S T G missense Het possibly damaging 0.944 phenotype 12/20/2019
29 607212 UTSW Marf1 0.210 R7855 G1 225.01 N 16 14114201 H1651N G T missense Het probably benign 0.270 phenotype 12/20/2019
30 607181 UTSW Mitf 0.916 R7855 G1 225.01 N 6 97993196 Y142N T A missense Het probably damaging 0.999 phenotype 12/20/2019
31 607187 UTSW Olfr569 0.261 R7855 G1 225.01 N 7 102887628 V175A A G missense Het probably benign 0.007 phenotype 12/20/2019
32 607188 UTSW Olfr620 0.080 R7855 G1 225.01 N 7 103611772 I194F T A missense Het possibly damaging 0.885 phenotype 12/20/2019
33 607199 UTSW Pecam1 0.128 R7855 G1 225.01 N 11 106671750 V708A A G missense Het probably benign 0.001 phenotype 12/20/2019
34 607183 UTSW Pinlyp 0.098 R7855 G1 225.01 N 7 24542440 C T critical splice donor site 1 bp Het probably null 12/20/2019
35 607217 UTSW Polh 0.299 R7855 G1 225.01 N 17 46175248 R382W G A missense Het probably damaging 1.000 phenotype 12/20/2019
36 607192 UTSW Prdm10 1.000 R7855 G1 225.01 N 9 31327474 I221V A G missense Het probably benign 0.041 phenotype 12/20/2019
37 607191 UTSW Pskh1 1.000 R7855 G1 225.01 N 8 105913090 R134L G T missense Het probably benign 0.151 phenotype 12/20/2019
38 607190 UTSW Ptpre 0.652 R7855 G1 225.01 N 7 135651995 N6D A G missense Het probably benign 0.000 phenotype 12/20/2019
39 607184 UTSW Rasgrp4 0.000 R7855 G1 225.01 N 7 29150610 P58L C T missense Het unknown phenotype 12/20/2019
40 607201 UTSW Rhbdf2 0.000 R7855 G1 225.01 N 11 116602240 C393* G T nonsense Het probably null phenotype 12/20/2019
41 607174 UTSW Rlf 1.000 R7855 G1 225.01 N 4 121182691 I174M T C missense Het possibly damaging 0.925 phenotype 12/20/2019
42 607205 UTSW Ryr2 1.000 R7855 G1 225.01 N 13 11706623 R2641* T A nonsense Het probably null phenotype 12/20/2019
43 607206 UTSW Simc1 0.076 R7855 G1 225.01 N 13 54524832 H331R A G missense Het probably benign 0.026 12/20/2019
44 607210 UTSW Skp2 0.000 R7855 G1 225.01 N 15 9122241 S256P A G missense Het probably benign 0.001 phenotype 12/20/2019
45 607198 UTSW Smarcd2 0.952 R7855 G1 225.01 N 11 106267566 R10G T C missense Het probably benign 0.174 phenotype 12/20/2019
46 607211 UTSW Spef2 0.146 R7855 G1 225.01 N 15 9687895 L480P A G missense Het possibly damaging 0.531 phenotype 12/20/2019
47 607186 UTSW Tenm4 1.000 R7855 G1 225.01 N 7 96873874 H1541R A G missense Het probably damaging 0.997 phenotype 12/20/2019
48 607172 UTSW Top1 1.000 R7855 G1 225.01 N 2 160714088 L489Q T A missense Het probably damaging 1.000 phenotype 12/20/2019
49 607185 UTSW Ttll13 0.199 R7855 G1 225.01 N 7 80254097 H258Y C T missense Het probably damaging 1.000 12/20/2019
50 607166 UTSW Unc80 0.895 R7855 G1 225.01 N 1 66483349 R237G A G missense Het possibly damaging 0.780 phenotype 12/20/2019
51 607182 UTSW Vmn1r55 0.058 R7855 G1 225.01 N 7 5146624 F267L A G missense Het probably benign 0.000 12/20/2019
52 607214 UTSW Vmn2r96 0.136 R7855 G1 225.01 N 17 18597868 M761K T A missense Het possibly damaging 0.592 12/20/2019
53 607177 UTSW Vps33a 1.000 R7855 G1 225.01 N 5 123570979 H58Y G A missense Het possibly damaging 0.778 phenotype 12/20/2019
54 607195 UTSW Zfp354c 0.075 R7855 G1 217.47 N 11 50815240 TCACACTCGGCACA TCACA small deletion Het probably benign 0.090 12/20/2019
55 607179 UTSW Zfp467 0.177 R7855 G1 225.01 N 6 48439181 Q179R T C missense Het probably damaging 0.990 phenotype 12/20/2019
56 607207 UTSW Zfp729a 0.073 R7855 G1 225.01 N 13 67619948 S721T A T missense Het possibly damaging 0.945 12/20/2019
[records 1 to 56 of 56]