Incidental Mutations

46 incidental mutations are currently displayed, and affect 45 genes.
8 are Possibly Damaging.
18 are Probably Damaging.
17 are Probably Benign.
2 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 46 of 46] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 607390 UTSW Abca3 1.000 R7859 G1 225.01 N 17 24384526 L564P T C missense Het probably damaging 1.000 phenotype 12/20/2019
2 607382 UTSW Arsb 0.241 R7859 G1 225.01 N 13 93862107 S308T T A missense Het probably benign 0.034 phenotype 12/20/2019
3 607386 UTSW Atxn10 1.000 R7859 G1 225.01 N 15 85462325 D428G A G missense Het probably benign 0.006 phenotype 12/20/2019
4 607365 UTSW BB014433 0.065 R7859 G1 217.47 N 8 15042160 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG small deletion Het probably benign 12/20/2019
5 607373 UTSW Cd300a 0.000 R7859 G1 225.01 N 11 114893339 Y58H T C missense Het probably benign 0.084 phenotype 12/20/2019
6 607387 UTSW Crkl 1.000 R7859 G1 225.01 N 16 17469096 M172K T A missense Het probably damaging 0.998 phenotype 12/20/2019
7 607362 UTSW Cyfip1 1.000 R7859 G1 225.01 N 7 55900026 I647T T C missense Het probably damaging 1.000 phenotype 12/20/2019
8 607392 UTSW Dlgap1 0.000 R7859 G1 225.01 N 17 70516688 T223A A G missense Het probably benign 0.000 12/20/2019
9 607357 UTSW Dmtf1 0.823 R7859 G1 225.01 N 5 9128044 S372G T C missense Het probably damaging 0.996 phenotype 12/20/2019
10 607395 UTSW Dock8 0.113 R7859 G1 225.01 N 19 25183570 V1814M G A missense Het probably damaging 0.999 phenotype 12/20/2019
11 607378 UTSW Dusp22 0.000 R7859 G1 225.01 N 13 30708754 K171N A C missense Het probably benign 0.014 12/20/2019
12 607371 UTSW Evi2a 1.000 R7859 G1 225.01 N 11 79527626 S53G T C missense Het probably benign 0.001 12/20/2019
13 607368 UTSW Ipcef1 0.099 R7859 G1 225.01 N 10 6890569 D376V T A missense Het probably damaging 1.000 0.250 12/20/2019
14 607363 UTSW Kndc1 0.000 R7859 G1 225.01 N 7 139920964 D723V A T missense Het possibly damaging 0.571 phenotype 12/20/2019
15 607355 UTSW Kti12 1.000 R7859 G1 225.01 N 4 108848246 E119A A C missense Het probably benign 0.000 12/20/2019
16 607356 UTSW Kti12 1.000 R7859 G1 225.01 N 4 108848247 E119D G T missense Het probably benign 0.001 12/20/2019
17 607379 UTSW Mcur1 0.000 R7859 G1 124.01 N 13 43560009 R40* G A nonsense Het probably null phenotype 12/20/2019
18 607358 UTSW Mgam 0.113 R7859 G1 225.01 N 6 40740179 N265K T A missense Het possibly damaging 0.749 phenotype 12/20/2019
19 607364 UTSW Muc6 0.082 R7859 G1 225.01 N 7 141645420 T1069I G A missense Het probably damaging 0.962 phenotype 12/20/2019
20 607370 UTSW Myh2 0.229 R7859 G1 225.01 N 11 67186700 L887P T C missense Het probably damaging 0.964 phenotype 12/20/2019
21 607372 UTSW Myo1d 0.000 R7859 G1 225.01 N 11 80684377 D171A T G missense Het probably damaging 0.999 12/20/2019
22 607366 UTSW Nat2 0.716 R7859 G1 225.01 N 8 67501350 F37L T A missense Het probably damaging 1.000 phenotype 12/20/2019
23 607353 UTSW Nkx2-2 1.000 R7859 G1 225.01 N 2 147177810 C236R A G missense Het unknown phenotype 12/20/2019
24 607384 UTSW Nrl 0.815 R7859 G1 225.01 N 14 55522125 S115L G A missense Het probably benign 0.011 phenotype 12/20/2019
25 607377 UTSW Nrsn1 0.000 R7859 G1 225.01 N 13 25262271 S41A A C missense Het probably damaging 0.998 12/20/2019
26 607393 UTSW Olfr1448 0.121 R7859 G1 225.01 N 19 12919982 E109V T A missense Het probably damaging 1.000 phenotype 12/20/2019
27 607351 UTSW Pax8 1.000 R7859 G1 225.01 N 2 24421555 H456L T A missense Het possibly damaging 0.931 phenotype 12/20/2019
28 607391 UTSW Pkd1 1.000 R7859 G1 225.01 N 17 24571280 I979K T A missense Het probably damaging 0.997 phenotype 12/20/2019
29 607350 UTSW Prex2 0.332 R7859 G1 225.01 N 1 11080050 N149D A G missense Het probably damaging 0.999 phenotype 12/20/2019
30 607361 UTSW Psg28 0.060 R7859 G1 225.01 N 7 18426224 V349D A T missense Het probably damaging 0.998 12/20/2019
31 607360 UTSW Ptpro 0.000 R7859 G1 225.01 N 6 137392807 G A critical splice donor site 1 bp Het probably null phenotype 12/20/2019
32 607380 UTSW Sema4d 0.000 R7859 G1 225.01 N 13 51722351 K94N T A missense Het probably benign 0.304 phenotype 12/20/2019
33 607385 UTSW Slc22a22 0.061 R7859 G1 225.01 N 15 57250952 D326E A T missense Het probably benign 0.024 12/20/2019
34 607375 UTSW Slc25a29 0.000 R7859 G1 225.01 N 12 108826830 T274I G A missense Het probably benign 0.009 phenotype 12/20/2019
35 607352 UTSW Slc43a1 0.097 R7859 G1 225.01 N 2 84856876 F374L T C missense Het possibly damaging 0.830 phenotype 12/20/2019
36 607367 UTSW Syne1 1.000 R7859 G1 225.01 N 10 5157683 Q520K G T missense Het possibly damaging 0.795 phenotype 12/20/2019
37 607369 UTSW Taar4 0.143 R7859 G1 225.01 N 10 23961134 V214A T C missense Het probably benign 0.348 phenotype 12/20/2019
38 607376 UTSW Tex22 0.083 R7859 G1 225.01 N 12 113088483 C54S T A missense Het possibly damaging 0.915 12/20/2019
39 607394 UTSW Tmem2 0.803 R7859 G1 225.01 N 19 21832175 I973N T A missense Het possibly damaging 0.948 12/20/2019
40 607374 UTSW Tpo 0.403 R7859 G1 225.01 N 12 30100574 I436F T A missense Het probably damaging 0.997 phenotype 12/20/2019
41 607354 UTSW Usp53 0.188 R7859 G1 225.01 N 3 122949766 H507R T C missense Het possibly damaging 0.909 phenotype 12/20/2019
42 607383 UTSW Usp54 0.000 R7859 G1 225.01 N 14 20588136 E255G T C missense Het probably benign 0.244 12/20/2019
43 607389 UTSW Vmn2r109 0.068 R7859 G1 225.01 N 17 20541174 F640L G T missense Het probably damaging 1.000 12/20/2019
44 607388 UTSW Vmn2r124 0.092 R7859 G1 225.01 N 17 18061950 Y80C A G missense Het probably damaging 1.000 12/20/2019
45 607359 UTSW Vmn2r27 0.078 R7859 G1 225.01 N 6 124224242 I252K A T missense Het probably benign 0.001 12/20/2019
46 607381 UTSW Zfp457 0.098 R7859 G1 225.01 N 13 67306381 A G start gained Het probably benign 12/20/2019
[records 1 to 46 of 46]