Incidental Mutations

82 incidental mutations are currently displayed, and affect 82 genes.
13 are Possibly Damaging.
27 are Probably Damaging.
21 are Probably Benign.
11 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 82 of 82] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 607501 UTSW 1700016H13Rik 0.000 R7861 G1 225.01 N 5 103649494 I50F T A missense Het possibly damaging 0.931 12/20/2019
2 607532 UTSW Abcc3 0.000 R7861 G1 225.01 N 11 94357249 D1175G T C missense Het probably null 0.999 phenotype 12/20/2019
3 607484 UTSW Accs 0.132 R7861 G1 225.01 N 2 93835732 *503L C A makesense Het probably null 12/20/2019
4 607521 UTSW Adgra2 1.000 R7861 G1 225.01 N 8 27114457 E520G A G missense Het probably damaging 0.977 phenotype 12/20/2019
5 607551 UTSW Aldh7a1 0.173 R7861 G1 225.01 N 18 56548453 C215F C A missense Het probably benign 0.027 phenotype 12/20/2019
6 607480 UTSW Apbb1ip 0.000 R7861 G1 225.01 N 2 22816978 D9A A C missense Het unknown phenotype 12/20/2019
7 607543 UTSW Atad2 0.329 R7861 G1 225.01 N 15 58125780 A228V G A missense Het probably benign 0.099 phenotype 12/20/2019
8 607514 UTSW Atp10a 0.409 R7861 G1 225.01 N 7 58788359 S430P T C missense Het probably damaging 0.999 p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 12/20/2019
9 607513 UTSW Atp1a3 1.000 R7861 G1 225.01 N 7 25001148 D6G T C missense Het unknown phenotype 12/20/2019
10 607534 UTSW Brca1 1.000 R7861 G1 225.01 N 11 101526422 N295K A T missense Het possibly damaging 0.873 phenotype 12/20/2019
11 607518 UTSW Caly 0.087 R7861 G1 225.01 N 7 140081388 C A intron Het probably benign phenotype 12/20/2019
12 607522 UTSW Ces1h 0.054 R7861 G1 225.01 N 8 93357425 Y386H A G missense Het unknown 12/20/2019
13 607542 UTSW Col14a1 0.000 R7861 G1 225.01 N 15 55444616 D1044G A G missense Het unknown phenotype 12/20/2019
14 607545 UTSW Csf2rb 1.000 R7861 G1 225.01 N 15 78349157 D888G A G missense Het probably damaging 1.000 phenotype 12/20/2019
15 607503 UTSW Cux1 0.905 R7861 G1 225.01 N 5 136252604 E568G T C missense Het possibly damaging 0.584 phenotype 12/20/2019
16 607544 UTSW Cyhr1 0.419 R7861 G1 225.01 N 15 76648186 D241N C T missense Het probably benign 0.286 12/20/2019
17 607531 UTSW Dhrs7b 0.784 R7861 G1 225.01 N 11 60855742 L219Q T A missense Het probably damaging 1.000 phenotype 12/20/2019
18 607539 UTSW Dlg5 1.000 R7861 G1 191.01 N 14 24245212 P80L G A missense Het probably damaging 0.999 0.307 phenotype 12/20/2019
19 607478 UTSW Dnah14 0.096 R7861 G1 225.01 N 1 181616759 P545S C T missense Het probably damaging 0.999 phenotype 12/20/2019
20 607485 UTSW Dnajc24 0.305 R7861 G1 225.01 N 2 106002035 M1K A T start codon destroyed Het probably null 0.998 phenotype 12/20/2019
21 607477 UTSW Dusp12 1.000 R7861 G1 225.01 N 1 170874526 W301* C T nonsense Het probably null phenotype 12/20/2019
22 607547 UTSW Dyrk1a 1.000 R7861 G1 225.01 N 16 94691716 G603* G T nonsense Het probably null phenotype 12/20/2019
23 607546 UTSW Eif4g1 0.967 R7861 G1 225.01 N 16 20679702 V403E T A missense Het probably benign 0.000 phenotype 12/20/2019
24 607533 UTSW Epn3 0.000 R7861 G1 225.01 N 11 94496274 E90G T C missense Het probably damaging 0.996 phenotype 12/20/2019
25 607479 UTSW Etl4 0.650 R7861 G1 225.01 N 2 20805910 S1303G A G missense Het probably benign 0.000 phenotype 12/20/2019
26 607535 UTSW Evpl 0.000 R7861 G1 225.01 N 11 116228069 Y627N A T missense Het probably damaging 1.000 phenotype 12/20/2019
27 607527 UTSW Fbxw25 0.073 R7861 G1 225.01 N 9 109664557 L22* A T nonsense Het probably null 12/20/2019
28 607476 UTSW Fcamr 0.068 R7861 G1 225.01 N 1 130814638 N587K T A missense Het probably benign 0.000 phenotype 12/20/2019
29 607530 UTSW Fgd6 0.582 R7861 G1 225.01 N 10 94103331 N946S A G missense Het probably benign 0.148 12/20/2019
30 607487 UTSW Fndc3b 1.000 R7861 G1 225.01 N 3 27468999 I477N A T missense Het possibly damaging 0.623 phenotype 12/20/2019
31 607505 UTSW Grifin 0.054 R7861 G1 225.01 N 5 140564525 A54T C T missense Het probably benign 0.036 12/20/2019
32 607489 UTSW Gtf2b 1.000 R7861 G1 225.01 N 3 142781344 I180M A G missense Het probably damaging 0.993 phenotype 12/20/2019
33 607492 UTSW Invs 0.699 R7861 G1 225.01 N 4 48397559 D378V A T missense Het possibly damaging 0.500 phenotype 12/20/2019
34 607482 UTSW Itgb6 0.919 R7861 G1 225.01 N 2 60628444 E378G T C missense Het probably damaging 1.000 phenotype 12/20/2019
35 607473 UTSW Khdc1a 0.069 R7861 G1 225.01 N 1 21350399 I81T T C missense Het possibly damaging 0.518 12/20/2019
36 607554 UTSW Kif20b 0.857 R7861 G1 225.01 N 19 34939922 D617E T A missense Het probably damaging 0.996 phenotype 12/20/2019
37 607523 UTSW Kifc3 0.000 R7861 G1 225.01 N 8 95107537 T A critical splice acceptor site Het probably null phenotype 12/20/2019
38 607525 UTSW Kirrel3 0.220 R7861 G1 225.01 N 9 35020123 H403Y C T missense Het possibly damaging 0.792 phenotype 12/20/2019
39 607507 UTSW Klf15 0.788 R7861 G1 225.01 N 6 90466838 V132I G A missense Het probably benign 0.005 phenotype 12/20/2019
40 607526 UTSW Kmt2a 1.000 R7861 G1 225.01 N 9 44818734 S3429P A G missense Het unknown phenotype 12/20/2019
41 607550 UTSW Lama1 1.000 R7861 G1 225.01 N 17 67809221 L2361R T G missense Het phenotype 12/20/2019
42 607481 UTSW Lrp1b 0.000 R7861 G1 225.01 N 2 40697558 D3895G T C missense Het phenotype 12/20/2019
43 607490 UTSW Mcoln3 0.194 R7861 G1 225.01 N 3 146124791 E92A A C missense Het possibly damaging 0.947 phenotype 12/20/2019
44 607483 UTSW Myo3b 0.000 R7861 G1 225.01 N 2 70108688 M135T T C missense Het probably damaging 0.999 phenotype 12/20/2019
45 607493 UTSW Mysm1 0.212 R7861 G1 225.01 N 4 94946967 *820Q A G makesense Het probably null phenotype 12/20/2019
46 607528 UTSW Ncoa7 0.000 R7861 G1 225.01 N 10 30691060 S541P A G missense Het probably benign 0.375 12/20/2019
47 607500 UTSW Nup54 0.960 R7861 G1 225.01 N 5 92431093 T33A T C missense Het unknown phenotype 12/20/2019
48 607548 UTSW Olfr118 0.084 R7861 G1 225.01 N 17 37672517 Q165K C A missense Het possibly damaging 0.910 phenotype 12/20/2019
49 607486 UTSW Olfr1290 0.076 R7861 G1 225.01 N 2 111490024 I45F T A missense Het probably damaging 0.991 phenotype 12/20/2019
50 607552 UTSW Olfr1496 0.095 R7861 G1 225.01 N 19 13781446 V276A T C missense Het possibly damaging 0.907 phenotype 12/20/2019
51 607519 UTSW Olfr45 0.066 R7861 G1 225.01 N 7 140691571 I222S T G missense Het probably damaging 1.000 phenotype 12/20/2019
52 607515 UTSW Olfr586 0.123 R7861 G1 225.01 N 7 103122692 I27F T A missense Het probably benign 0.028 phenotype 12/20/2019
53 607491 UTSW Otud6b 0.124 R7861 G1 225.01 N 4 14826414 C18R A G missense Het probably benign 0.000 phenotype 12/20/2019
54 607538 UTSW Pde4d 0.000 R7861 G1 225.01 N 13 109935324 E284G A G missense Het probably damaging 0.993 phenotype 12/20/2019
55 607506 UTSW Peg10 1.000 R7861 G1 217.47 N 6 4756431 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC small deletion Het probably benign phenotype 12/20/2019
56 607520 UTSW Pidd1 0.000 R7861 G1 225.01 N 7 141440142 W598L C A missense Het probably damaging 0.999 phenotype 12/20/2019
57 607510 UTSW Pira2 0.073 R7861 G1 225.01 N 7 3844544 C49S A T missense Het probably damaging 1.000 12/20/2019
58 607495 UTSW Pramef6 0.053 R7861 G1 225.01 N 4 143897718 M70V T C missense Het possibly damaging 0.747 12/20/2019
59 607494 UTSW Prdx1 0.653 R7861 G1 225.01 N 4 116693738 D135E T G missense Het probably benign 0.000 phenotype 12/20/2019
60 607537 UTSW Rab15 0.000 R7861 G1 225.01 N 12 76803129 Y88F T A missense Het probably damaging 1.000 12/20/2019
61 607540 UTSW Rem2 0.096 R7861 G1 225.01 N 14 54477799 H144Q C A missense Het probably damaging 1.000 12/20/2019
62 607497 UTSW Sel1l3 0.000 R7861 G1 225.01 N 5 53144064 D737G T C missense Het probably damaging 0.962 12/20/2019
63 607498 UTSW Srd5a3 1.000 R7861 G1 225.01 N 5 76147819 Q119* C T nonsense Het probably null phenotype 12/20/2019
64 607508 UTSW Suclg2 0.000 R7861 G1 225.01 N 6 95594722 Q120K G T missense Het probably benign 0.002 phenotype 12/20/2019
65 607517 UTSW Tacc2 0.000 R7861 G1 225.01 N 7 130625431 M1282K T A missense Het probably benign 0.002 phenotype 12/20/2019
66 607549 UTSW Tbc1d5 0.000 R7861 G1 225.01 N 17 50756692 Q620L T A missense Het probably damaging 0.993 12/20/2019
67 607541 UTSW Tdrd3 0.538 R7861 G1 225.01 N 14 87472154 A91S G T missense Het probably damaging 0.999 phenotype 12/20/2019
68 607475 UTSW Thsd7b 0.163 R7861 G1 225.01 N 1 130159698 F1184Y T A missense Het probably benign 0.001 12/20/2019
69 607512 UTSW Trim28 1.000 R7861 G1 225.01 N 7 13028412 V321E T A missense Het possibly damaging 0.674 phenotype 12/20/2019
70 607516 UTSW Trim5 0.070 R7861 G1 225.01 N 7 104266468 C A critical splice donor site 1 bp Het probably null 12/20/2019
71 607499 UTSW Ugt2b37 0.065 R7861 G1 225.01 N 5 87242440 Y382* A T nonsense Het probably null 12/20/2019
72 607474 UTSW Usp40 0.000 R7861 G1 225.01 N 1 87982130 G534D C T missense Het probably damaging 0.988 phenotype 12/20/2019
73 607488 UTSW Usp53 0.212 R7861 G1 225.01 N 3 122934463 H823Q A T missense Het probably benign 0.257 phenotype 12/20/2019
74 607502 UTSW Vmn2r12 0.069 R7861 G1 167.01 N 5 109087963 M508L T A missense Het probably benign 0.002 12/20/2019
75 607511 UTSW Vmn2r56 0.097 R7861 G1 225.01 N 7 12715424 I296F T A missense Het probably benign 0.001 12/20/2019
76 607553 UTSW Vps13a 0.000 R7861 G1 225.01 N 19 16655304 S2563G T C missense Het probably damaging 1.000 phenotype 12/20/2019
77 607524 UTSW Wdr59 1.000 R7861 G1 225.01 N 8 111494280 F207L A G missense Het 12/20/2019
78 607504 UTSW Zan 0.073 R7861 G1 225.01 N 5 137407033 S3777P A G missense Het unknown phenotype 12/20/2019
79 607536 UTSW Zfp277 0.082 R7861 G1 225.01 N 12 40315881 N530D T C missense Het possibly damaging 0.924 phenotype 12/20/2019
80 607529 UTSW Zfp365 0.000 R7861 G1 225.01 N 10 67909919 R10W G A missense Het probably damaging 0.976 phenotype 12/20/2019
81 607509 UTSW Zfp384 0.191 R7861 G1 225.01 N 6 125036325 H452L A T missense Het probably damaging 0.999 phenotype 12/20/2019
82 607496 UTSW Zfyve28 0.000 R7861 G1 225.01 N 5 34217143 L509Q A T missense Het probably damaging 0.999 12/20/2019
[records 1 to 82 of 82]