Incidental Mutations

58 incidental mutations are currently displayed, and affect 58 genes.
11 are Possibly Damaging.
22 are Probably Damaging.
18 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 58 of 58] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 608054 UTSW 1700017N19Rik 0.074 R7870 G1 225.01 N 10 100605643 F171L T A missense Het probably benign 0.000 12/20/2019
2 608076 UTSW 2410137M14Rik 0.057 R7870 G1 225.01 N 17 36978017 C152S A T missense Het unknown 12/20/2019
3 608037 UTSW Alb 0.155 R7870 G1 225.01 N 5 90472629 F533L T C missense Het possibly damaging 0.956 phenotype 12/20/2019
4 608059 UTSW Alox12b 1.000 R7870 G1 225.01 N 11 69169309 M616T T C missense Het possibly damaging 0.758 phenotype 12/20/2019
5 608050 UTSW Atxn2l 0.925 R7870 G1 225.01 N 7 126492752 F968L A G missense Het probably benign 0.000 phenotype 12/20/2019
6 608041 UTSW Cadps2 0.000 R7870 G1 225.01 N 6 23263642 H1227Q G T missense Het probably benign 0.141 phenotype 12/20/2019
7 608068 UTSW Cdh18 0.101 R7870 G1 225.01 N 15 23474327 D761V A T missense Het possibly damaging 0.944 phenotype 12/20/2019
8 608057 UTSW Cdkl3 0.850 R7870 G1 225.01 N 11 52018457 T C critical splice donor site 2 bp Het probably null phenotype 12/20/2019
9 608047 UTSW Chrdl2 0.325 R7870 G1 225.01 N 7 100010042 L9P T C missense Het unknown phenotype 12/20/2019
10 608049 UTSW Ctr9 1.000 R7870 G1 225.01 N 7 111052411 E946G A G missense Het unknown phenotype 12/20/2019
11 608061 UTSW Cygb 0.000 R7870 G1 225.01 N 11 116649290 T178S T A missense Het probably benign 0.002 phenotype 12/20/2019
12 608081 UTSW Cyp2c67 0.096 R7870 G1 225.01 N 19 39609225 M443R A C missense Het probably damaging 1.000 12/20/2019
13 608064 UTSW Dnah12 0.221 R7870 G1 225.01 N 14 26856529 T3082A A G missense Het probably benign 0.001 12/20/2019
14 608042 UTSW Flnc 1.000 R7870 G1 225.01 N 6 29454307 T1906I C T missense Het probably damaging 1.000 phenotype 12/20/2019
15 608032 UTSW Gm14496 0.000 R7870 G1 225.01 N 2 181996113 I327V A G missense Het probably benign 0.092 12/20/2019
16 608026 UTSW Gm29106 0.356 R7870 G1 225.01 N 1 118199155 N192K T A missense Het possibly damaging 0.546 12/20/2019
17 608027 UTSW H3f3a 0.453 R7870 G1 225.01 N 1 180811925 M1K A T start codon destroyed Het probably null 0.613 phenotype 12/20/2019
18 608035 UTSW Htt 1.000 R7870 G1 225.01 N 5 34898547 W2601R T A missense Het possibly damaging 0.769 phenotype 12/20/2019
19 608024 UTSW Il18r1 0.000 R7870 G1 225.01 N 1 40491136 I341K T A missense Het probably benign 0.447 phenotype 12/20/2019
20 608052 UTSW Kcnj1 0.083 R7870 G1 225.01 N 9 32396585 V102I G A missense Het probably benign 0.170 phenotype 12/20/2019
21 608046 UTSW Lrp3 0.153 R7870 G1 225.01 N 7 35211497 G41V C A missense Het probably damaging 0.993 12/20/2019
22 608062 UTSW Lrrc9 0.172 R7870 G1 225.01 N 12 72486190 K944N G T missense Het probably damaging 0.989 12/20/2019
23 608025 UTSW Mettl21e 0.076 R7870 G1 225.01 N 1 44210211 E95V T A missense Het probably damaging 1.000 12/20/2019
24 608077 UTSW Mib1 1.000 R7870 G1 225.01 N 18 10798446 R769Q G A missense Het possibly damaging 0.754 phenotype 12/20/2019
25 608066 UTSW Myh7 0.769 R7870 G1 225.01 N 14 54988801 D461H C G missense Het probably damaging 1.000 0.947 phenotype 12/20/2019
26 608028 UTSW Mymk 1.000 R7870 G1 225.01 N 2 27062286 S190P A G missense Het probably damaging 0.963 phenotype 12/20/2019
27 608029 UTSW Neb 0.762 R7870 G1 225.01 N 2 52325749 P182L G A missense Het probably damaging 0.995 phenotype 12/20/2019
28 608063 UTSW Nfil3 0.000 R7870 G1 225.01 N 13 52968413 Y152H A G missense Het probably damaging 0.993 phenotype 12/20/2019
29 608065 UTSW Nisch 0.000 R7870 G1 225.01 N 14 31172095 Y1174H A G missense Het probably damaging 0.999 phenotype 12/20/2019
30 608039 UTSW Nyap1 0.143 R7870 G1 225.01 N 5 137735396 Y458* G C nonsense Het probably null phenotype 12/20/2019
31 608072 UTSW Olfr183 0.082 R7870 G1 225.01 N 16 58999723 V13I G A missense Het probably benign 0.001 phenotype 12/20/2019
32 608048 UTSW Olfr618 0.063 R7870 G1 225.01 N 7 103598266 C317S T A missense Het probably damaging 0.999 phenotype 12/20/2019
33 608053 UTSW Olfr984 0.215 R7870 G1 225.01 N 9 40100677 V271G A C missense Het possibly damaging 0.929 phenotype 12/20/2019
34 608034 UTSW Pars2 0.915 R7870 G1 225.01 N 4 106654079 Y353N T A missense Het probably damaging 1.000 phenotype 12/20/2019
35 608033 UTSW Patj 0.000 R7870 G1 225.01 N 4 98424316 G297V G T missense Het probably damaging 1.000 phenotype 12/20/2019
36 608067 UTSW Pcdh9 0.228 R7870 G1 225.01 N 14 93887257 S492R A T missense Het probably damaging 0.967 phenotype 12/20/2019
37 608043 UTSW Pcyox1 0.000 R7870 G1 225.01 N 6 86392341 R168C G A missense Het probably damaging 1.000 phenotype 12/20/2019
38 608044 UTSW Plbd1 0.000 R7870 G1 225.01 N 6 136617328 Y308N A T missense Het possibly damaging 0.810 phenotype 12/20/2019
39 608079 UTSW Rax 0.780 R7870 G1 225.01 N 18 65938213 V117A A G missense Het probably benign 0.094 phenotype 12/20/2019
40 608055 UTSW Rdh9 0.000 R7870 G1 225.01 N 10 127776697 N71K C A missense Het probably benign 0.000 phenotype 12/20/2019
41 608078 UTSW Sap130 0.950 R7870 G1 225.01 N 18 31720661 N968S A G missense Het probably benign 0.149 phenotype 12/20/2019
42 608069 UTSW Sema5a 1.000 R7870 G1 225.01 N 15 32609339 I464F A T missense Het probably benign 0.226 phenotype 12/20/2019
43 608038 UTSW Sez6l 0.000 R7870 G1 225.01 N 5 112438581 D683A T G missense Het probably damaging 1.000 phenotype 12/20/2019
44 608036 UTSW Slit2 1.000 R7870 G1 225.01 N 5 48302307 P1310T C A missense Het probably damaging 0.988 phenotype 12/20/2019
45 608058 UTSW Snap47 0.000 R7870 G1 225.01 N 11 59438078 M133V T C missense Het probably benign 0.108 12/20/2019
46 608073 UTSW Son 0.955 R7870 G1 121.46 N 16 91656598 TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC unclassified Het probably benign phenotype 12/20/2019
47 608051 UTSW Srcap 0.964 R7870 G1 225.01 N 7 127560558 S3202N G A missense Het unknown phenotype 12/20/2019
48 608060 UTSW Ssh2 0.266 R7870 G1 225.01 N 11 77453615 W809R T C missense Het probably benign 0.000 phenotype 12/20/2019
49 608031 UTSW Stau1 0.000 R7870 G1 225.01 N 2 166950950 A365D G T missense Het possibly damaging 0.892 phenotype 12/20/2019
50 608040 UTSW Tfpi2 0.148 R7870 G1 225.01 N 6 3968281 L15P A G missense Het probably damaging 0.996 0.647 phenotype 12/20/2019
51 608030 UTSW Thbs1 0.000 R7870 G1 225.01 N 2 118115027 N329I A T missense Het possibly damaging 0.464 phenotype 12/20/2019
52 608070 UTSW Tmem65 0.202 R7870 G1 225.01 N 15 58787161 D184E A T missense Het probably damaging 0.995 12/20/2019
53 608080 UTSW Trpm6 1.000 R7870 G1 225.01 N 19 18815241 E676D G T missense Het probably benign 0.015 phenotype 12/20/2019
54 608071 UTSW Vdr 0.000 R7870 G1 225.01 N 15 97884890 D17A T G missense Het possibly damaging 0.592 phenotype 12/20/2019
55 608045 UTSW Vmn1r123 R7870 G1 225.01 N 7 21162267 T28I C T missense Het probably damaging 1.000 12/20/2019
56 608075 UTSW Wdr90 0.152 R7870 G1 225.01 N 17 25860539 L207P A G missense Het probably damaging 0.963 12/20/2019
57 608056 UTSW Zfp354c 0.077 R7870 G1 217.47 N 11 50815238 TGTCACACTCG TG small deletion Het probably benign 12/20/2019
58 608074 UTSW Zfp598 0.959 R7870 G1 225.01 N 17 24679330 E402G A G missense Het probably damaging 0.977 phenotype 12/20/2019
[records 1 to 58 of 58]