Incidental Mutations

62 incidental mutations are currently displayed, and affect 62 genes.
8 are Possibly Damaging.
20 are Probably Damaging.
26 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 608213 UTSW Acta2 0.257 R7872 G1 225.01 N 19 34243439 D290N C T missense Het probably damaging 0.992 phenotype 12/20/2019
2 608185 UTSW Adam18 0.000 R7872 G1 225.01 N 8 24611100 D682G T C missense Het probably benign 0.001 phenotype 12/20/2019
3 608202 UTSW Ankrd46 0.161 R7872 G1 225.01 N 15 36485843 V88A A G missense Het possibly damaging 0.511 phenotype 12/20/2019
4 608161 UTSW Ankub1 0.000 R7872 G1 225.01 N 3 57665386 K305I T A missense Het probably damaging 0.999 12/20/2019
5 608158 UTSW Atrn 0.000 R7872 G1 225.01 N 2 130970227 T A critical splice donor site 2 bp Het probably null phenotype 12/20/2019
6 608209 UTSW Bambi 0.179 R7872 G1 225.01 N 18 3511406 T76S A T missense Het probably benign 0.025 phenotype 12/20/2019
7 608186 UTSW Cacna1a 0.932 R7872 G1 225.01 N 8 84583654 V1447E T A missense Het probably damaging 1.000 phenotype 12/20/2019
8 608191 UTSW Calcoco2 0.000 R7872 G1 113.53 N 11 96099982 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC small deletion Het probably benign 12/20/2019
9 608206 UTSW Clcn2 0.358 R7872 G1 225.01 N 16 20708460 M629T A G missense Het probably damaging 0.988 phenotype 12/20/2019
10 608178 UTSW Clcn4 0.000 R7872 G1 225.01 N 7 7287781 N673S T C missense Het probably benign 0.000 phenotype 12/20/2019
11 608159 UTSW Col20a1 0.000 R7872 G1 225.01 N 2 180986578 F15S T C missense Het probably benign 0.137 12/20/2019
12 608204 UTSW Col2a1 1.000 R7872 G1 225.01 N 15 98000577 Q39* G A nonsense Het probably null phenotype 12/20/2019
13 608166 UTSW Creb3 0.784 R7872 G1 225.01 N 4 43563332 E119G A G missense Het probably benign 0.036 phenotype 12/20/2019
14 608201 UTSW Dnah5 0.641 R7872 G1 225.01 N 15 28245684 D556A A C missense Het probably damaging 0.994 phenotype 12/20/2019
15 608189 UTSW Edar 0.260 R7872 G1 225.01 N 10 58610526 M192I C T missense Het possibly damaging 0.879 phenotype 12/20/2019
16 608203 UTSW Fam91a1 0.000 R7872 G1 225.01 N 15 58448360 M634V A G missense Het probably benign 0.013 phenotype 12/20/2019
17 608167 UTSW Fbxo10 0.000 R7872 G1 225.01 N 4 45051699 V471I C T missense Het not run phenotype 12/20/2019
18 608152 UTSW Fer1l5 0.083 R7872 G1 225.01 N 1 36421886 F2032L T C missense Het probably benign 0.003 12/20/2019
19 608160 UTSW Gm5150 0.075 R7872 G1 225.01 N 3 16006321 M1R A C start codon destroyed Het probably null 0.374 12/20/2019
20 608153 UTSW Grin1 1.000 R7872 G1 225.01 N 2 25298190 E509G T C missense Het probably benign 0.014 phenotype 12/20/2019
21 608176 UTSW Igkv10-94 R7872 G1 225.01 N 6 68704929 C T critical splice donor site Het probably benign 12/20/2019
22 608180 UTSW Il18bp 0.000 R7872 G1 225.01 N 7 102016795 Y59H A G missense Het possibly damaging 0.915 phenotype 12/20/2019
23 608165 UTSW Ints8 0.964 R7872 G1 194.01 N 4 11254062 C17S A T missense Het probably benign 0.004 phenotype 12/20/2019
24 608190 UTSW Kcnmb1 0.000 R7872 G1 225.01 N 11 33966275 Y74H T C missense Het probably damaging 1.000 phenotype 12/20/2019
25 608207 UTSW Kpna1 0.411 R7872 G1 225.01 N 16 36023195 V313A T C missense Het probably benign 0.002 phenotype 12/20/2019
26 608156 UTSW Lrp4 0.733 R7872 G1 225.01 N 2 91490716 T1029I C T missense Het possibly damaging 0.539 phenotype 12/20/2019
27 608164 UTSW Lrrc7 0.751 R7872 G1 225.01 N 3 158353462 C3S A T missense Het probably damaging 0.989 phenotype 12/20/2019
28 608195 UTSW Lyst 0.311 R7872 G1 225.01 N 13 13635865 H707N C A missense Het probably benign 0.143 phenotype 12/20/2019
29 608155 UTSW Map3k20 0.000 R7872 G1 225.01 N 2 72371754 K148R A G missense Het probably damaging 0.972 phenotype 12/20/2019
30 608199 UTSW Mcidas 0.000 R7872 G1 225.01 N 13 112998987 G315S G A missense Het probably damaging 1.000 phenotype 12/20/2019
31 608171 UTSW Miip 0.073 R7872 G1 225.01 N 4 147862918 G236S C T missense Het probably benign 0.171 phenotype 12/20/2019
32 608208 UTSW Mocs1 1.000 R7872 G1 225.01 N 17 49439533 I177N T A missense Het probably damaging 1.000 phenotype 12/20/2019
33 608184 UTSW Muc5b 0.191 R7872 G1 225.01 N 7 141846113 D441G A G missense Het unknown phenotype 12/20/2019
34 608192 UTSW Ncoa1 0.000 R7872 G1 225.01 N 12 4278186 N884S T C missense Het probably benign 0.001 phenotype 12/20/2019
35 608181 UTSW Olfr33 0.218 R7872 G1 225.01 N 7 102714182 V77A A G missense Het probably benign 0.008 phenotype 12/20/2019
36 608183 UTSW Olfr533 0.119 R7872 G1 225.01 N 7 140466783 N194S A G missense Het probably damaging 1.000 phenotype 12/20/2019
37 608170 UTSW Padi6 0.000 R7872 G1 225.01 N 4 140727762 F621L A T missense Het probably damaging 0.997 phenotype 12/20/2019
38 608198 UTSW Pde8b 0.149 R7872 G1 225.01 N 13 95086839 M197I C A missense Het possibly damaging 0.506 phenotype 12/20/2019
39 608162 UTSW Pear1 0.000 R7872 G1 225.01 N 3 87752215 I771L T A missense Het probably benign 0.000 phenotype 12/20/2019
40 608210 UTSW Poli 0.000 R7872 G1 225.01 N 18 70522820 L281P A G missense Het probably damaging 1.000 phenotype 12/20/2019
41 608154 UTSW Prdm12 1.000 R7872 G1 225.01 N 2 31640219 W41R T C missense Het probably damaging 0.999 12/20/2019
42 608205 UTSW Prkdc 0.948 R7872 G1 225.01 N 16 15715006 S1500A T G missense Het probably benign 0.050 phenotype 12/20/2019
43 608211 UTSW Prune2 0.000 R7872 G1 225.01 N 19 17119434 H767Q T A missense Het probably benign 0.047 phenotype 12/20/2019
44 608172 UTSW Rasgef1b 0.094 R7872 G1 225.01 N 5 99234544 Q196* G A nonsense Het probably null 12/20/2019
45 608163 UTSW Rnpc3 1.000 R7872 G1 225.01 N 3 113622447 L121* A T nonsense Het probably null phenotype 12/20/2019
46 608200 UTSW Rpp14 0.937 R7872 G1 225.01 N 14 8083724 M1V A G start codon destroyed Het probably null 0.003 12/20/2019
47 608194 UTSW Ryr2 1.000 R7872 G1 225.01 N 13 11595724 D4072V T A missense Het probably damaging 0.999 phenotype 12/20/2019
48 608212 UTSW Sgms1 0.917 R7872 G1 225.01 N 19 32125365 H314R T C missense Het probably damaging 0.991 phenotype 12/20/2019
49 608193 UTSW Six4 0.000 R7872 G1 217.47 N 12 73104239 CT C critical splice acceptor site Het probably benign 0.085 phenotype 12/20/2019
50 608174 UTSW Slc37a3 0.000 R7872 G1 225.01 N 6 39347310 Y335N A T missense Het probably damaging 1.000 12/20/2019
51 608157 UTSW Tcp11l1 0.095 R7872 G1 225.01 N 2 104706492 H9Q A T missense Het probably benign 0.250 12/20/2019
52 608182 UTSW Tnrc6a 0.861 R7872 G1 225.01 N 7 123179834 M1256K T A missense Het probably damaging 0.989 phenotype 12/20/2019
53 608187 UTSW Trpc6 0.000 R7872 G1 225.01 N 9 8609909 N126S A G missense Het probably damaging 0.998 phenotype 12/20/2019
54 608169 UTSW Ubr4 1.000 R7872 G1 225.01 N 4 139393062 F266S T C missense Het possibly damaging 0.942 phenotype 12/20/2019
55 608197 UTSW Uimc1 0.214 R7872 G1 225.01 N 13 55069737 V424A A G missense Het possibly damaging 0.784 phenotype 12/20/2019
56 608188 UTSW Utrn 0.000 R7872 G1 225.01 N 10 12698129 I1066V T C missense Het probably benign 0.000 phenotype 12/20/2019
57 608196 UTSW Vmn1r204 0.068 R7872 G1 225.01 N 13 22556234 T12A A G missense Het probably benign 0.001 12/20/2019
58 608177 UTSW Vmn1r57 0.064 R7872 G1 225.01 N 7 5220614 I46N T A missense Het possibly damaging 0.479 12/20/2019
59 608179 UTSW Vmn1r91 R7872 G1 225.01 N 7 20101914 Y253H T C missense Het probably benign 0.259 12/20/2019
60 608173 UTSW Vmn2r14 0.127 R7872 G1 225.01 N 5 109221353 H118L T A missense Het probably benign 0.023 12/20/2019
61 608168 UTSW Zcchc11 0.000 R7872 G1 225.01 N 4 108517518 C933G T G missense Het probably damaging 0.999 phenotype 12/20/2019
62 608175 UTSW Zfp775 0.146 R7872 G1 225.01 N 6 48620470 K426R A G missense Het probably benign 0.000 12/20/2019
[records 1 to 62 of 62]