Incidental Mutations

51 incidental mutations are currently displayed, and affect 51 genes.
13 are Possibly Damaging.
20 are Probably Damaging.
10 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 51 of 51] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 609123 UTSW Alkbh8 0.000 R7887 G1 225.01 Y 9 3385343 I580N T A missense Het probably damaging 0.994 phenotype 12/20/2019
2 609102 UTSW Ankrd35 0.000 R7887 G1 225.01 Y 3 96684900 T834M C T missense Het probably damaging 0.999 12/20/2019
3 609104 UTSW Astn2 0.087 R7887 G1 225.01 Y 4 65644866 V893I C T missense Het possibly damaging 0.511 phenotype 12/20/2019
4 609103 UTSW B4galt1 0.000 R7887 G1 225.01 Y 4 40823501 Y197H A G missense Het probably benign 0.082 phenotype 12/20/2019
5 609108 UTSW Brdt 0.000 R7887 G1 225.01 Y 5 107359933 S676P T C missense Het possibly damaging 0.662 phenotype 12/20/2019
6 609118 UTSW Chrdl2 0.240 R7887 G1 225.01 Y 7 100029250 V343A T C missense Het possibly damaging 0.889 0.107 phenotype 12/20/2019
7 609121 UTSW Clcn3 0.636 R7887 G1 225.01 Y 8 60941399 M59K A T missense Het probably benign 0.162 0.415 phenotype 12/20/2019
8 609125 UTSW Cpne4 0.067 R7887 G1 225.01 Y 9 105032791 N529I A T missense Het probably damaging 1.000 phenotype 12/20/2019
9 609112 UTSW Crcp 0.892 R7887 G1 225.01 Y 5 130037870 K32N G T missense Het possibly damaging 0.937 phenotype 12/20/2019
10 609111 UTSW Ddx54 1.000 R7887 G1 225.01 Y 5 120627203 R846C C T missense Het probably damaging 0.999 phenotype 12/20/2019
11 609132 UTSW Dennd6a 0.224 R7887 G1 225.01 Y 14 26599657 S118P T C missense Het possibly damaging 0.502 12/20/2019
12 609138 UTSW Egr3 0.787 R7887 G1 225.01 Y 14 70079202 Y116C A G missense Het probably damaging 0.998 0.381 phenotype 12/20/2019
13 609126 UTSW Fbxw25 0.064 R7887 G1 225.01 Y 9 109649594 A G critical splice donor site 2 bp Het probably null 12/20/2019
14 609105 UTSW Focad 0.564 R7887 G1 225.01 Y 4 88182616 I313M T G missense Het probably damaging 0.998 12/20/2019
15 609127 UTSW Gm10272 0.080 R7887 G1 225.01 Y 10 77706945 P107L C T missense Het probably benign 0.062 12/20/2019
16 609120 UTSW Gpr26 0.059 R7887 G1 217.01 Y 7 131966973 I16L A C missense Het probably benign 0.000 phenotype 12/20/2019
17 609094 UTSW Gpr39 0.000 R7887 G1 225.01 Y 1 125677542 T69K C A missense Het probably damaging 0.994 phenotype 12/20/2019
18 609134 UTSW Hacl1 0.000 R7887 G1 225.01 Y 14 31634227 G97S C T missense Het probably damaging 1.000 0.920 12/20/2019
19 609100 UTSW Idh3b 0.000 R7887 G1 225.01 Y 2 130281758 D136E A C missense Het probably damaging 1.000 phenotype 12/20/2019
20 609096 UTSW Irf6 0.841 R7887 G1 225.01 Y 1 193167732 V321M G A missense Het probably damaging 1.000 phenotype 12/20/2019
21 609114 UTSW Klrg2 0.073 R7887 G1 225.01 Y 6 38636571 T166S T A missense Het probably damaging 0.995 12/20/2019
22 609113 UTSW Lnx2 0.117 R7887 G1 225.01 Y 5 147019043 I648V T C missense Het probably damaging 0.999 12/20/2019
23 628773 UTSW Mecr 1.000 R7887 G1 225.01 Y 4 131860866 A G splice site 3 bp Het probably null 06/25/2020
24 609128 UTSW Mnat1 1.000 R7887 G1 225.01 Y 12 73188191 S205T T A missense Het probably benign 0.447 phenotype 12/20/2019
25 609139 UTSW Mpnd 0.257 R7887 G1 225.01 Y 17 56011097 G204D G A missense Het probably benign 0.027 12/20/2019
26 609136 UTSW Myh7 0.866 R7887 G1 225.01 Y 14 54983662 E935K C T missense Het possibly damaging 0.794 0.548 phenotype 12/20/2019
27 609129 UTSW Nid1 0.219 R7887 G1 225.01 Y 13 13499733 R899L G T missense Het possibly damaging 0.831 phenotype 12/20/2019
28 609133 UTSW Nisch 0.000 R7887 G1 225.01 Y 14 31176695 W664* C T nonsense Het probably null 0.976 phenotype 12/20/2019
29 609101 UTSW Nudt6 0.112 R7887 G1 225.01 Y 3 37412380 V157I C T missense Het possibly damaging 0.949 phenotype 12/20/2019
30 609099 UTSW Olfr1156 0.087 R7887 G1 225.01 Y 2 87949880 M118V T C missense Het probably damaging 0.999 phenotype 12/20/2019
31 609119 UTSW Olfr573-ps1 0.075 R7887 G1 225.01 Y 7 102942151 L142R A C missense Het possibly damaging 0.936 0.171 12/20/2019
32 609124 UTSW Olfr949-ps1 R7887 G1 225.01 Y 9 39364879 M107L A T missense Het unknown 12/20/2019
33 609140 UTSW Onecut2 0.742 R7887 G1 225.01 Y 18 64340975 M180K T A missense Het possibly damaging 0.533 0.391 phenotype 12/20/2019
34 609135 UTSW Parg 1.000 R7887 G1 225.01 Y 14 32217662 D548E T A missense Het possibly damaging 0.845 0.061 phenotype 12/20/2019
35 609107 UTSW Pclo 0.000 R7887 G1 217.47 N 5 14714190 GTCTAT GTCTATTCTAT frame shift Het probably null phenotype 12/20/2019
36 609137 UTSW Phf11d 0.083 R7887 G1 225.01 Y 14 59359580 Y57H A G missense Het probably damaging 1.000 0.853 phenotype 12/20/2019
37 609122 UTSW Prkaca 0.576 R7887 G1 225.01 Y 8 83986895 V99A T C missense Het probably benign 0.070 0.556 phenotype 12/20/2019
38 609131 UTSW Rnf144b 0.000 R7887 G1 225.01 Y 13 47239811 C209S T A missense Het probably damaging 1.000 0.974 12/20/2019
39 609093 UTSW Scly 0.099 R7887 G1 225.01 Y 1 91300641 G A critical splice donor site 1 bp Het probably null phenotype 12/20/2019
40 609109 UTSW Selplg 0.074 R7887 G1 214.46 N 5 113819695 GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT unclassified Het probably benign phenotype 12/20/2019
41 609092 UTSW Sphkap 0.086 R7887 G1 225.01 Y 1 83277412 Y872C T C missense Het probably benign 0.001 12/20/2019
42 609110 UTSW Ssh1 0.000 R7887 G1 225.01 Y 5 113961349 C T critical splice donor site 1 bp Het probably null phenotype 12/20/2019
43 609115 UTSW Strap 1.000 R7887 G1 225.01 Y 6 137739809 L129V T G missense Het possibly damaging 0.929 0.148 phenotype 12/20/2019
44 609117 UTSW Sympk 0.967 R7887 G1 225.01 Y 7 19034439 I111T T C missense Het possibly damaging 0.688 phenotype 12/20/2019
45 609097 UTSW Tprn 0.000 R7887 G1 225.01 Y 2 25264012 A442E C A missense Het probably damaging 0.967 phenotype 12/20/2019
46 609116 UTSW Tsen34 0.881 R7887 G1 225.01 Y 7 3694708 L36P T C missense Het probably damaging 1.000 phenotype 12/20/2019
47 609106 UTSW Ubr4 1.000 R7887 G1 225.01 Y 4 139407810 F818L T C missense Het probably damaging 0.993 phenotype 12/20/2019
48 609091 UTSW Uggt1 0.604 R7887 G1 225.01 Y 1 36208034 Y294C T C missense Het probably damaging 0.990 0.633 phenotype 12/20/2019
49 609098 UTSW Usp20 0.000 R7887 G1 225.01 Y 2 31020894 K862E A G missense Het probably benign 0.341 phenotype 12/20/2019
50 609130 UTSW Vmn1r201 0.165 R7887 G1 225.01 Y 13 22474786 I57F A T missense Het probably damaging 0.991 0.633 12/20/2019
51 609095 UTSW Wdr64 0.065 R7887 G1 225.01 N 1 175785545 A662V C T missense Het not run 12/20/2019
[records 1 to 51 of 51]