Incidental Mutations

52 incidental mutations are currently displayed, and affect 52 genes.
5 are Possibly Damaging.
20 are Probably Damaging.
20 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 52 of 52] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 649037 UTSW Abl1 0.940 R7941 G1 213.01 Y 2 31689679 T C start gained Het probably benign phenotype 09/15/2020
2 649055 UTSW AI467606 0.000 R7941 G1 225.01 Y 7 127092421 E56G A G missense Het probably damaging 1.000 09/15/2020
3 649060 UTSW Ak9 0.175 R7941 G1 225.01 Y 10 41409137 P1403S C T missense Het unknown 0.201 phenotype 09/15/2020
4 649067 UTSW Akr1c14 0.000 R7941 G1 225.01 Y 13 4059713 K28E A G missense Het probably benign 0.000 0.085 09/15/2020
5 649042 UTSW Ampd2 0.175 R7941 G1 225.01 Y 3 108080116 V134L C A missense Het probably benign 0.000 0.085 phenotype 09/15/2020
6 649062 UTSW Anks1b 0.000 R7941 G1 225.01 Y 10 90577155 N55I A T missense Het probably damaging 0.979 0.214 phenotype 09/15/2020
7 649048 UTSW C87414 0.082 R7941 G1 107.01 N 5 93638028 V131D A T missense Het probably benign 0.039 09/15/2020
8 649074 UTSW Cabyr 0.073 R7941 G1 225.01 Y 18 12744768 L54P T C missense Het probably damaging 1.000 phenotype 09/15/2020
9 649045 UTSW Cachd1 0.184 R7941 G1 225.01 Y 4 100988173 N954I A T missense Het probably damaging 0.996 09/15/2020
10 649035 UTSW Cenpf 0.631 R7941 G1 225.01 Y 1 189657286 S1450P A G missense Het probably damaging 0.999 phenotype 09/15/2020
11 649033 UTSW Chst10 0.169 R7941 G1 225.01 Y 1 38871691 I131L T A missense Het probably damaging 0.997 phenotype 09/15/2020
12 649065 UTSW Cluh 0.259 R7941 G1 225.01 Y 11 74659757 M270L A T missense Het probably benign 0.005 0.080 phenotype 09/15/2020
13 649078 UTSW Dagla 0.000 R7941 G1 225.01 N 19 10271503 H29R T C missense Het probably damaging 0.994 phenotype 09/15/2020
14 649080 UTSW Dusp5 0.000 R7941 G1 225.01 N 19 53537533 N202S A G missense Het probably benign 0.000 phenotype 09/15/2020
15 649057 UTSW Elavl3 0.419 R7941 G1 225.01 Y 9 22036316 I110T A G missense Het possibly damaging 0.938 phenotype 09/15/2020
16 649066 UTSW Fam222b 0.306 R7941 G1 225.01 Y 11 78155059 G482V G T missense Het possibly damaging 0.904 0.073 09/15/2020
17 649068 UTSW Fbxl7 0.000 R7941 G1 225.01 Y 15 26543613 L316P A G missense Het probably damaging 1.000 phenotype 09/15/2020
18 656366 UTSW Gad1 1.000 R7941 G1 225.01 Y 2 70594585 T A splice site Het probably null 0.976 phenotype 10/29/2020
19 649073 UTSW H2-K1 0.126 R7941 G1 225.01 N 17 33999331 T204A T C missense Het probably benign 0.000 phenotype 09/15/2020
20 649034 UTSW Hmcn1 0.000 R7941 G1 225.01 Y 1 150650084 V3296A A G missense Het possibly damaging 0.948 phenotype 09/15/2020
21 649058 UTSW Hyal1 0.148 R7941 G1 225.01 Y 9 107578100 F203S T C missense Het probably damaging 1.000 phenotype 09/15/2020
22 649054 UTSW Il16 0.178 R7941 G1 225.01 Y 7 83682829 D181V T A missense Het probably damaging 0.983 0.158 phenotype 09/15/2020
23 649059 UTSW Ip6k1 0.335 R7941 G1 225.01 Y 9 108024432 F69L T C missense Het probably damaging 0.995 phenotype 09/15/2020
24 649043 UTSW Klf4 1.000 R7941 G1 225.01 Y 4 55531755 G A intron Het probably benign 0.085 phenotype 09/15/2020
25 649052 UTSW Lsr 1.000 R7941 G1 225.01 Y 7 30973095 I27L T G missense Het probably benign 0.000 phenotype 09/15/2020
26 656369 UTSW Mettl4 0.374 R7941 G1 225.01 Y 17 94733194 A T splice site Het probably null 0.976 10/29/2020
27 649044 UTSW Mpdz 0.000 R7941 G1 225.01 Y 4 81282750 V1902A A G missense Het probably benign 0.035 0.070 phenotype 09/15/2020
28 649070 UTSW Nfkbiz 0.674 R7941 G1 225.01 Y 16 55821944 G37D C T missense Het probably damaging 0.980 phenotype 09/15/2020
29 649039 UTSW Olfr1131 0.085 R7941 G1 225.01 Y 2 87628904 V31A T C missense Het probably benign 0.059 phenotype 09/15/2020
30 656367 UTSW Otogl 0.000 R7941 G1 225.01 Y 10 107806802 A T splice site Het probably null phenotype 10/29/2020
31 649075 UTSW Pcdh1 0.435 R7941 G1 225.01 N 18 38199080 D429G T C missense Het probably damaging 1.000 phenotype 09/15/2020
32 649076 UTSW Prelid2 0.000 R7941 G1 225.01 Y 18 41932751 L73* A T nonsense Het probably null 09/15/2020
33 649051 UTSW Psg20 0.048 R7941 G1 225.01 Y 7 18681177 T A critical splice acceptor site Het probably null 09/15/2020
34 649063 UTSW Ptprb 1.000 R7941 G1 112.46 N 10 116283677 GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT small deletion Het probably benign phenotype 09/15/2020
35 656368 UTSW Rab24 0.000 R7941 G1 225.01 Y 13 55320307 C T splice site 5 bp Het probably null phenotype 10/29/2020
36 649040 UTSW Rag1 0.443 R7941 G1 225.01 Y 2 101642346 K817T T G missense Het probably benign 0.241 phenotype 09/15/2020
37 649072 UTSW Rgl2 0.113 R7941 G1 225.01 Y 17 33931739 V57A T C missense Het probably benign 0.002 0.071 09/15/2020
38 649079 UTSW Ric1 0.466 R7941 G1 225.01 Y 19 29533259 M80T T C missense Het probably damaging 0.998 09/15/2020
39 649061 UTSW Sh3rf3 0.163 R7941 G1 225.01 Y 10 59007061 I283T T C missense Het probably damaging 0.989 09/15/2020
40 649046 UTSW Skint2 0.059 R7941 G1 225.01 Y 4 112625990 N197K C A missense Het probably damaging 0.996 09/15/2020
41 649036 UTSW Snapc4 1.000 R7941 G1 225.01 Y 2 26376718 I126T A G missense Het probably damaging 0.978 phenotype 09/15/2020
42 649056 UTSW Srcap 0.963 R7941 G1 107.47 N 7 127558290 GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT unclassified Het probably benign phenotype 09/15/2020
43 649053 UTSW Svip 0.163 R7941 G1 225.01 Y 7 52003413 K51R T C missense Het probably benign 0.000 phenotype 09/15/2020
44 649041 UTSW Syndig1 0.129 R7941 G1 225.01 Y 2 149899788 V98E T A missense Het probably benign 0.366 0.120 phenotype 09/15/2020
45 649077 UTSW Tshz1 1.000 R7941 G1 225.01 N 18 84015392 M297K A T missense Het possibly damaging 0.911 phenotype 09/15/2020
46 649038 UTSW Ttn 1.000 R7941 G1 225.01 Y 2 76919350 V3785A A G missense Het probably benign 0.000 0.081 phenotype 09/15/2020
47 649069 UTSW Usf3 0.308 R7941 G1 225.01 Y 16 44215561 S135P T C missense Het probably damaging 0.999 09/15/2020
48 649049 UTSW Vmn2r10 0.076 R7941 G1 225.01 Y 5 108996440 M548K A T missense Het probably damaging 0.997 09/15/2020
49 649071 UTSW Vmn2r92 0.079 R7941 G1 225.01 N 17 18184837 S748P T C missense Het possibly damaging 0.895 09/15/2020
50 649064 UTSW Zbtb39 0.155 R7941 G1 225.01 Y 10 127743540 Y661C A G missense Het probably damaging 1.000 09/15/2020
51 649047 UTSW Zfp804b 0.156 R7941 G1 225.01 Y 5 6770042 I1007T A G missense Het probably benign 0.001 0.090 09/15/2020
52 649050 UTSW Zscan4-ps2 0.185 R7941 G1 225.01 N 7 11517672 I212V A G missense Het probably benign 0.421 09/15/2020
[records 1 to 52 of 52]