Incidental Mutations

57 incidental mutations are currently displayed, and affect 57 genes.
8 are Possibly Damaging.
15 are Probably Damaging.
24 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 57 of 57] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 649933 UTSW 4930430A15Rik 0.065 R7958 G1 225.01 Y 2 111170325 E183G T C missense Het unknown 09/15/2020
2 649941 UTSW 4930590J08Rik 0.000 R7958 G1 225.01 Y 6 91934483 T571S A T missense Het probably benign 0.022 0.085 09/15/2020
3 649963 UTSW Abca8a 0.059 R7958 G1 225.01 Y 11 110031672 Y1362H A G missense Het probably damaging 1.000 09/15/2020
4 649958 UTSW Aldh1l2 0.000 R7958 G1 225.01 Y 10 83520338 V63I C T missense Het probably benign 0.003 0.130 phenotype 09/15/2020
5 649946 UTSW Alg8 1.000 R7958 G1 225.01 Y 7 97386921 C340R T C missense Het possibly damaging 0.652 phenotype 09/15/2020
6 649936 UTSW BC028528 0.097 R7958 G1 225.01 Y 3 95888912 D46G T C missense Het probably benign 0.011 09/15/2020
7 649951 UTSW Cdh5 1.000 R7958 G1 225.01 Y 8 104113017 H40L A T missense Het probably benign 0.009 phenotype 09/15/2020
8 649925 UTSW Cul3 1.000 R7958 G1 225.01 Y 1 80271557 T666A T C missense Het probably benign 0.109 0.138 phenotype 09/15/2020
9 649966 UTSW Cwc27 0.000 R7958 G1 225.01 Y 13 104804964 D150G T C missense Het probably benign 0.009 phenotype 09/15/2020
10 649945 UTSW Cyp2a12 0.092 R7958 G1 225.01 Y 7 27029252 N49K T A missense Het probably benign 0.130 0.085 09/15/2020
11 649967 UTSW Dhrs4 0.225 R7958 G1 225.01 Y 14 55487621 L191P T C missense Het probably damaging 1.000 phenotype 09/15/2020
12 649978 UTSW Dusp9 0.163 R7958 G1 205.48 N X 73640611 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG small deletion Het probably benign 0.085 phenotype 09/15/2020
13 649930 UTSW Fam171a1 0.168 R7958 G1 225.01 Y 2 3178261 S41R T A missense Het probably damaging 1.000 09/15/2020
14 649971 UTSW Fam186a 0.058 R7958 G1 225.01 Y 15 99943308 L1685H A T missense Het probably damaging 0.986 09/15/2020
15 649947 UTSW Fgfr1 1.000 R7958 G1 225.01 Y 8 25532342 W2L G T missense Het probably benign 0.000 phenotype 09/15/2020
16 649975 UTSW Fpr-rs6 0.176 R7958 G1 225.01 Y 17 20182443 I219F T A missense Het probably damaging 0.984 09/15/2020
17 649926 UTSW Gm28360 0.144 R7958 G1 225.01 Y 1 117853679 C133* T A nonsense Het probably null 09/15/2020
18 649954 UTSW Herc1 0.000 R7958 G1 225.01 Y 9 66486193 D4118G A G missense Het probably damaging 0.999 phenotype 09/15/2020
19 649955 UTSW Hhatl 0.000 R7958 G1 225.01 Y 9 121784586 A G critical splice donor site 2 bp Het probably null 09/15/2020
20 649949 UTSW Inpp4b 0.286 R7958 G1 225.01 Y 8 81969589 L384H T A missense Het probably damaging 1.000 phenotype 09/15/2020
21 649927 UTSW Klhl12 0.000 R7958 G1 225.01 Y 1 134467717 R139K G A missense Het probably benign 0.024 phenotype 09/15/2020
22 649942 UTSW Klrg1 0.000 R7958 G1 225.01 Y 6 122271372 *189C T A makesense Het probably null 0.826 phenotype 09/15/2020
23 649972 UTSW Krtap19-4 0.210 R7958 G1 225.01 Y 16 88884945 F41S A G missense Het unknown 09/15/2020
24 649969 UTSW Lifr 1.000 R7958 G1 225.01 Y 15 7181997 V672A T C missense Het possibly damaging 0.615 phenotype 09/15/2020
25 649948 UTSW Lrrc25 0.097 R7958 G1 225.01 Y 8 70617847 T93A A G missense Het possibly damaging 0.659 09/15/2020
26 649956 UTSW Map7 0.330 R7958 G1 225.01 Y 10 20229829 S9T T A missense Het unknown phenotype 09/15/2020
27 649968 UTSW Mycbp2 1.000 R7958 G1 225.01 Y 14 103129964 F4281L A T missense Het probably benign 0.001 phenotype 09/15/2020
28 649961 UTSW Myh10 1.000 R7958 G1 225.01 Y 11 68721347 I162V A G missense Het probably benign 0.004 0.066 phenotype 09/15/2020
29 649962 UTSW Myo18a 1.000 R7958 G1 225.01 Y 11 77841557 V1293A T C missense Het probably damaging 0.999 phenotype 09/15/2020
30 649970 UTSW Nipbl 0.968 R7958 G1 225.01 Y 15 8311258 S1993P A G missense Het possibly damaging 0.913 phenotype 09/15/2020
31 649924 UTSW Nrp2 0.944 R7958 G1 225.01 Y 1 62745408 R239C C T missense Het probably damaging 1.000 0.335 phenotype 09/15/2020
32 649939 UTSW Oas2 0.077 R7958 G1 225.01 Y 5 120748766 E112K C T missense Het probably benign 0.002 0.085 phenotype 09/15/2020
33 649953 UTSW Olfr151 R7958 G1 225.01 Y 9 37730386 F199S A G missense Het probably damaging 1.000 09/15/2020
34 649977 UTSW Oosp3 0.377 R7958 G1 225.01 Y 19 11705456 I163F A T missense Het probably benign 0.074 09/15/2020
35 649950 UTSW Phkb 0.778 R7958 G1 225.01 Y 8 86021663 E710D G T missense Het probably benign 0.001 phenotype 09/15/2020
36 649952 UTSW Plekhg4 0.226 R7958 G1 225.01 Y 8 105376649 D318V A T missense Het possibly damaging 0.856 phenotype 09/15/2020
37 649932 UTSW Ptprj 0.187 R7958 G1 225.01 Y 2 90469627 I277V T C missense Het possibly damaging 0.712 phenotype 09/15/2020
38 649960 UTSW Ranbp17 0.000 R7958 G1 225.01 Y 11 33487702 S179P A G missense Het probably damaging 0.999 phenotype 09/15/2020
39 649973 UTSW Scaf8 0.805 R7958 G1 225.01 Y 17 3171122 V295M G A missense Het unknown 0.089 09/15/2020
40 649931 UTSW Scn3a 1.000 R7958 G1 225.01 Y 2 65506193 I690F T A missense Het probably damaging 1.000 0.241 phenotype 09/15/2020
41 649965 UTSW Serpinb1b 0.079 R7958 G1 225.01 Y 13 33089653 K110N A T missense Het possibly damaging 0.902 09/15/2020
42 649964 UTSW Sgsh 0.093 R7958 G1 225.01 Y 11 119352773 N41S T C missense Het probably damaging 0.981 phenotype 09/15/2020
43 649928 UTSW Sh2d1b1 0.067 R7958 G1 225.01 Y 1 170283135 T67A A G missense Het probably benign 0.207 phenotype 09/15/2020
44 649937 UTSW Skint5 0.058 R7958 G1 225.01 Y 4 113623783 L958M A T missense Het unknown 09/15/2020
45 656337 UTSW Spg11 0.233 R7958 G1 225.01 Y 2 122092945 T A splice site 20 bp Het probably null phenotype 10/22/2020
46 649934 UTSW Spo11 0.000 R7958 G1 225.01 Y 2 172984022 D84E T A missense Het probably benign 0.001 phenotype 09/15/2020
47 649929 UTSW Spta1 0.857 R7958 G1 225.01 Y 1 174174390 E29K G A missense Het probably benign 0.026 phenotype 09/15/2020
48 649976 UTSW Srrm2 0.946 R7958 G1 225.01 Y 17 23821312 V2310A T C missense Het probably benign 0.246 09/15/2020
49 649959 UTSW Tbc1d30 0.000 R7958 G1 225.01 Y 10 121272057 R480L C A missense Het probably benign 0.351 0.074 09/15/2020
50 656336 UTSW Tbpl2 0.372 R7958 G1 225.01 Y 2 24095067 A T splice site Het probably null phenotype 10/22/2020
51 649957 UTSW Tjp3 0.000 R7958 G1 225.01 Y 10 81282994 V69I C T missense Het possibly damaging 0.555 0.171 phenotype 09/15/2020
52 649938 UTSW Ube3b 1.000 R7958 G1 225.01 Y 5 114401423 V425A T C missense Het probably benign 0.045 phenotype 09/15/2020
53 649944 UTSW Vmn1r151 R7958 G1 149.01 N 7 22499067 S204R A T missense Het probably damaging 1.000 09/15/2020
54 649940 UTSW Vmn1r42 0.059 R7958 G1 225.01 Y 6 89845077 I170N A T missense Het probably damaging 0.992 0.633 09/15/2020
55 649943 UTSW Vmn1r65 0.051 R7958 G1 225.01 Y 7 6008255 S327P A G missense Het probably benign 0.006 09/15/2020
56 649974 UTSW Vmn2r104 0.104 R7958 G1 225.01 Y 17 20042726 I158V T C missense Het probably benign 0.000 09/15/2020
57 649935 UTSW Wdr49 0.078 R7958 G1 225.01 Y 3 75431147 M21L T A missense Het probably benign 0.075 phenotype 09/15/2020
[records 1 to 57 of 57]