Incidental Mutations

55 incidental mutations are currently displayed, and affect 55 genes.
6 are Possibly Damaging.
18 are Probably Damaging.
21 are Probably Benign.
6 are Probably Null.
5 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 650684 UTSW Abhd16a 0.445 R7972 G1 225.01 Y 17 35101311 V384E T A missense Het probably damaging 0.987 0.616 phenotype 09/15/2020
2 650655 UTSW Acacb 0.000 R7972 G1 225.01 Y 5 114226857 R1533* C T nonsense Het probably null 0.976 phenotype 09/15/2020
3 650671 UTSW Alox12 0.151 R7972 G1 225.01 Y 11 70242687 M604L T A missense Het probably benign 0.148 phenotype 09/15/2020
4 650666 UTSW Amotl2 0.273 R7972 G1 225.01 Y 9 102723769 T345I C T missense Het probably benign 0.001 0.085 phenotype 09/15/2020
5 650653 UTSW Brdt 0.000 R7972 G1 225.01 Y 5 107348549 I176F A T missense Het possibly damaging 0.528 0.093 phenotype 09/15/2020
6 650651 UTSW Cdk5 0.509 R7972 G1 225.01 Y 5 24419658 T245K G T missense Het probably benign 0.000 0.066 phenotype 09/15/2020
7 650662 UTSW Chd9 0.000 R7972 G1 225.01 Y 8 91005767 R1304S A T missense Het unknown 09/15/2020
8 650683 UTSW Clpsl2 0.063 R7972 G1 225.01 Y 17 28550728 G55R G A missense Het probably damaging 0.998 0.236 09/15/2020
9 650647 UTSW Cyp2j11 0.071 R7972 G1 225.01 Y 4 96297634 E438V T A missense Het probably damaging 0.997 09/15/2020
10 650654 UTSW Dao 0.055 R7972 G1 213.47 Y 5 114015209 AGG AG critical splice donor site Het probably benign 0.085 phenotype 09/15/2020
11 650656 UTSW Dnah10 0.000 R7972 G1 225.01 Y 5 124726885 V92A T C missense Het probably benign 0.000 0.084 phenotype 09/15/2020
12 650636 UTSW Dusp27 0.000 R7972 G1 225.01 Y 1 166099139 E968V T A missense Het probably damaging 1.000 0.208 09/15/2020
13 650676 UTSW Evl 0.000 R7972 G1 225.01 Y 12 108681524 R295* C T nonsense Het probably null 0.976 phenotype 09/15/2020
14 650668 UTSW Fam184a 0.181 R7972 G1 225.01 Y 10 53638259 L1022Q A T missense Het probably damaging 1.000 09/15/2020
15 650687 UTSW Foxd4 0.000 R7972 G1 225.01 N 19 24900230 H202R T C missense Het probably damaging 1.000 phenotype 09/15/2020
16 650658 UTSW Fry 0.596 R7972 G1 225.01 Y 5 150310396 V16A T C missense Het probably benign 0.050 09/15/2020
17 650646 UTSW Gstcd 0.000 R7972 G1 225.01 Y 3 133072133 F306I A T missense Het probably benign 0.101 09/15/2020
18 650677 UTSW Hist1h2bl R7972 G1 225.01 N 13 21715807 S113P A G missense Het possibly damaging 0.599 phenotype 09/15/2020
19 650648 UTSW Hivep3 0.000 R7972 G1 225.01 Y 4 120097514 V1009A T C missense Het possibly damaging 0.483 0.171 phenotype 09/15/2020
20 650639 UTSW Hoxd12 0.387 R7972 G1 225.01 Y 2 74675925 R227L G T missense Het probably damaging 0.997 0.633 phenotype 09/15/2020
21 650637 UTSW Ifi208 0.000 R7972 G1 225.01 Y 1 173678990 M113K T A missense Het possibly damaging 0.682 09/15/2020
22 650672 UTSW Kcnh4 0.000 R7972 G1 225.01 Y 11 100752452 T330P T G missense Het probably damaging 0.978 phenotype 09/15/2020
23 650679 UTSW Kctd17 0.000 R7972 G1 217.47 Y 15 78436913 CAGCTGGAGGAGC CAGC unclassified Het probably benign 0.085 phenotype 09/15/2020
24 650650 UTSW Lin28a 1.000 R7972 G1 225.01 Y 4 134006263 P158S G A missense Het probably damaging 0.965 0.110 phenotype 09/15/2020
25 650664 UTSW Muc16 0.163 R7972 G1 225.01 Y 9 18645764 E3078* C A nonsense Het probably null phenotype 09/15/2020
26 650686 UTSW Naaladl1 0.179 R7972 G1 225.01 Y 19 6106244 N120S A G missense Het probably damaging 1.000 0.199 09/15/2020
27 650674 UTSW Nol10 0.966 R7972 G1 225.01 Y 12 17352647 R40H G A missense Het probably benign 0.154 0.118 09/15/2020
28 650645 UTSW Ntng1 0.000 R7972 G1 225.01 Y 3 110135486 S8L G A missense Het probably benign 0.017 0.081 phenotype 09/15/2020
29 650641 UTSW Olfr1212 0.065 R7972 G1 225.01 Y 2 88958833 Y122* T A nonsense Het probably null 0.972 phenotype 09/15/2020
30 650642 UTSW Olfr1243 0.065 R7972 G1 225.01 Y 2 89527604 I269L T G missense Het probably benign 0.023 0.085 phenotype 09/15/2020
31 650682 UTSW Pacsin1 0.123 R7972 G1 225.01 Y 17 27708639 F319I T A missense Het unknown phenotype 09/15/2020
32 650643 UTSW Pla2g4d 0.062 R7972 G1 225.01 Y 2 120278932 T212I G A missense Het probably benign 0.042 0.103 phenotype 09/15/2020
33 650685 UTSW Ppp4r1 0.000 R7972 G1 225.01 Y 17 65833098 C664S T A missense Het possibly damaging 0.896 phenotype 09/15/2020
34 650661 UTSW Prodh2 0.113 R7972 G1 225.01 N 7 30511155 I377T T C missense Het probably damaging 0.998 phenotype 09/15/2020
35 650669 UTSW Prss57 0.058 R7972 G1 225.01 Y 10 79783396 L243H A T missense Het probably benign 0.155 phenotype 09/15/2020
36 650675 UTSW Pxdn 0.593 R7972 G1 225.01 Y 12 30006602 L1271F C T missense Het probably damaging 0.990 phenotype 09/15/2020
37 650667 UTSW Ros1 0.156 R7972 G1 225.01 Y 10 52154830 R581* G A nonsense Het probably null phenotype 09/15/2020
38 650638 UTSW Rps6kc1 0.000 R7972 G1 225.01 Y 1 190799124 G894S C T missense Het probably benign 0.145 0.076 09/15/2020
39 650673 UTSW Sirt7 0.464 R7972 G1 225.01 Y 11 120619190 S183P A G missense Het unknown phenotype 09/15/2020
40 650663 UTSW Slc12a4 0.204 R7972 G1 225.01 Y 8 105951605 R319W G A missense Het possibly damaging 0.945 0.077 phenotype 09/15/2020
41 650681 UTSW Son 0.956 R7972 G1 142.47 N 16 91660334 AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG small deletion Het probably benign phenotype 09/15/2020
42 650635 UTSW Tbc1d8 0.000 R7972 G1 225.01 Y 1 39392169 F374S A G missense Het probably damaging 0.999 09/15/2020
43 650688 UTSW Tdrd1 0.430 R7972 G1 225.01 Y 19 56848702 D489E T A missense Het probably damaging 0.977 0.351 phenotype 09/15/2020
44 656507 UTSW Tiprl 1.000 R7972 G1 58.01 Y 1 165236974 T A unclassified Het probably benign 0.085 phenotype 12/07/2020
45 650678 UTSW Tpt1 1.000 R7972 G1 225.01 Y 14 75848099 *173Q T C makesense Het probably null phenotype 09/15/2020
46 650670 UTSW Trim17 0.000 R7972 G1 225.01 Y 11 58968568 I203V A G missense Het probably benign 0.011 0.085 phenotype 09/15/2020
47 650665 UTSW Trim43b 0.069 R7972 G1 225.01 N 9 89091308 H124L T A missense Het probably damaging 1.000 09/15/2020
48 650680 UTSW Triobp 1.000 R7972 G1 225.01 Y 15 78967986 I780T T C missense Het probably damaging 0.999 0.116 phenotype 09/15/2020
49 650640 UTSW Ttc30a1 0.485 R7972 G1 225.01 Y 2 75980458 M427K A T missense Het probably damaging 1.000 0.916 09/15/2020
50 650660 UTSW Tyrobp R7972 G1 225.01 N 7 30414638 G101R G A missense Het phenotype 09/15/2020
51 650659 UTSW Vmn1r181 0.049 R7972 G1 225.01 N 7 23984446 H112L A T missense Het probably benign 0.297 09/15/2020
52 650652 UTSW Wdr19 1.000 R7972 G1 225.01 Y 5 65223850 N406D A G missense Het probably damaging 1.000 0.539 phenotype 09/15/2020
53 650649 UTSW Zc3h12a 0.786 R7972 G1 225.01 Y 4 125119935 K379E T C missense Het probably benign 0.434 0.066 phenotype 09/15/2020
54 650657 UTSW Zcwpw1 0.158 R7972 G1 225.01 Y 5 137801061 I230T T C missense Het probably benign 0.129 09/15/2020
55 650644 UTSW Zfhx4 0.728 R7972 G1 225.01 Y 3 5412473 T3383A A G missense Het probably benign 0.021 0.057 09/15/2020
[records 1 to 55 of 55]