Incidental Mutations

47 incidental mutations are currently displayed, and affect 47 genes.
13 are Possibly Damaging.
10 are Probably Damaging.
16 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 47 of 47] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 616914 UTSW 2010315B03Rik 0.082 R8011 G1 225.01 Y 9 124293899 E132K C T missense Het 01/23/2020
2 616896 UTSW Acss2 0.176 R8011 G1 225.01 Y 2 155555957 I313T T C missense Het possibly damaging 0.734 0.778 phenotype 01/23/2020
3 616910 UTSW Akap13 1.000 R8011 G1 225.01 Y 7 75730465 R462H G A missense Het probably damaging 0.998 0.211 phenotype 01/23/2020
4 616909 UTSW Ankrd27 0.000 R8011 G1 225.01 Y 7 35616881 V524A T C missense Het probably benign 0.014 0.073 01/23/2020
5 616889 UTSW Cacna1e 0.182 R8011 G1 225.01 Y 1 154465822 I1209V T C missense Het probably benign 0.012 phenotype 01/23/2020
6 616905 UTSW Cntn3 0.000 R8011 G1 225.01 Y 6 102437899 I29N A T missense Het possibly damaging 0.932 01/23/2020
7 628789 UTSW Col5a1 1.000 R8011 G1 225.01 Y 2 27980521 G A splice site Het probably benign 0.085 phenotype 06/25/2020
8 616903 UTSW Cttnbp2 0.000 R8011 G1 225.01 Y 6 18426093 A762G G C missense Het possibly damaging 0.580 0.146 phenotype 01/23/2020
9 628791 UTSW Edc3 0.000 R8011 G1 225.01 Y 9 57713376 C A splice site Het probably benign phenotype 06/25/2020
10 616921 UTSW Egflam 0.000 R8011 G1 225.01 Y 15 7247044 M547K A T missense Het possibly damaging 0.895 0.551 phenotype 01/23/2020
11 616901 UTSW Fgr 0.151 R8011 G1 225.01 Y 4 132998479 Y400H T C missense Het probably damaging 0.999 0.799 phenotype 01/23/2020
12 616918 UTSW Gaa 0.469 R8011 G1 225.01 Y 11 119272936 P205S C T missense Het probably benign 0.001 phenotype 01/23/2020
13 616895 UTSW Gm14139 0.085 R8011 G1 225.01 Y 2 150192346 S196G A G missense Het possibly damaging 0.702 0.171 01/23/2020
14 616916 UTSW Gpr6 0.000 R8011 G1 225.01 Y 10 41070915 T224S T A missense Het probably benign 0.011 phenotype 01/23/2020
15 628790 UTSW Hes3 0.337 R8011 G1 189.01 Y 4 152287481 T C intron Het probably benign phenotype 06/25/2020
16 616913 UTSW Hydin 0.565 R8011 G1 225.01 Y 8 110583909 F4079S T C missense Het probably damaging 0.999 phenotype 01/23/2020
17 616922 UTSW Igf2bp2 0.182 R8011 G1 225.01 Y 16 22076099 I366N A T missense Het probably damaging 0.999 phenotype 01/23/2020
18 616902 UTSW Kmt2c 1.000 R8011 G1 225.01 Y 5 25351234 V1171A A G missense Het probably damaging 0.994 phenotype 01/23/2020
19 616911 UTSW Kndc1 0.000 R8011 G1 225.01 Y 7 139910620 F346Y T A missense Het possibly damaging 0.896 0.171 phenotype 01/23/2020
20 616926 UTSW Lpin2 0.290 R8011 G1 225.01 Y 17 71230375 G306R G A missense Het probably benign 0.428 0.098 phenotype 01/23/2020
21 628792 UTSW Mok 0.140 R8011 G1 225.01 Y 12 110814917 T C utr 3 prime Het probably benign phenotype 06/25/2020
22 616928 UTSW Nolc1 0.000 R8011 G1 225.01 Y 19 46081584 V265A T C missense Het unknown 01/23/2020
23 616897 UTSW Ogfr 0.488 R8011 G1 152.46 N 2 180595266 GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG unclassified Het probably benign phenotype 01/23/2020
24 616892 UTSW Olfr1018 0.077 R8011 G1 225.01 Y 2 85823613 L214R T G missense Het possibly damaging 0.898 phenotype 01/23/2020
25 616893 UTSW Olfr1106 0.070 R8011 G1 225.01 Y 2 87048846 L130R A C missense Het probably damaging 0.999 phenotype 01/23/2020
26 616894 UTSW Olfr1195 0.133 R8011 G1 225.01 Y 2 88683193 Q180* G A nonsense Het probably null phenotype 01/23/2020
27 616886 UTSW Olfr1415 0.082 R8011 G1 225.01 Y 1 92491275 V160A A G missense Het possibly damaging 0.600 0.484 phenotype 01/23/2020
28 616924 UTSW Parp14 0.491 R8011 G1 225.01 Y 16 35856634 T988I G A missense Het probably benign 0.001 phenotype 01/23/2020
29 616891 UTSW Pdk1 0.000 R8011 G1 225.01 Y 2 71875452 Q81H A T missense Het probably benign 0.045 phenotype 01/23/2020
30 616888 UTSW Plekha6 0.225 R8011 G1 225.01 Y 1 133263806 T38A A G missense Het probably benign 0.000 01/23/2020
31 616890 UTSW Pou2f1 1.000 R8011 G1 225.01 Y 1 165894903 A G critical splice donor site 2 bp Het probably null phenotype 01/23/2020
32 616919 UTSW Rgs6 0.136 R8011 G1 225.01 Y 12 83116292 D424G A G missense Het probably null 0.323 0.143 phenotype 01/23/2020
33 616898 UTSW Rnf13 0.000 R8011 G1 225.01 Y 3 57807070 Y183* T G nonsense Het probably null phenotype 01/23/2020
34 616920 UTSW Ryr2 1.000 R8011 G1 225.01 Y 13 11588140 A T critical splice donor site 2 bp Het probably null phenotype 01/23/2020
35 616887 UTSW Serpinb7 0.062 R8011 G1 225.01 Y 1 107434757 S64T T A missense Het possibly damaging 0.872 0.112 phenotype 01/23/2020
36 616927 UTSW Six2 1.000 R8011 G1 225.01 Y 17 85687672 E94G T C missense Het probably damaging 1.000 phenotype 01/23/2020
37 616900 UTSW Slc44a5 0.074 R8011 G1 225.01 Y 3 154247810 I276M A G missense Het possibly damaging 0.712 0.113 01/23/2020
38 616907 UTSW Smco2 0.000 R8011 G1 225.01 Y 6 146868135 Y239C A G missense Het probably damaging 0.992 01/23/2020
39 616899 UTSW Ssx2ip 0.000 R8011 G1 225.01 Y 3 146422911 S148P T C missense Het probably damaging 0.970 0.143 phenotype 01/23/2020
40 616925 UTSW Tiam2 0.000 R8011 G1 225.01 Y 17 3448396 Y816H T C missense Het possibly damaging 0.916 phenotype 01/23/2020
41 616923 UTSW Tnk2 0.298 R8011 G1 225.01 Y 16 32668365 R127C C T missense Het probably benign 0.003 phenotype 01/23/2020
42 616915 UTSW Tpd52l1 0.000 R8011 G1 225.01 Y 10 31332917 N185S T C missense Het probably benign 0.000 phenotype 01/23/2020
43 616904 UTSW Try5 0.091 R8011 G1 225.01 Y 6 41313487 D21G T C missense Het probably benign 0.121 0.070 01/23/2020
44 616906 UTSW Vmn2r20 0.530 R8011 G1 225.01 Y 6 123396410 V491A A G missense Het possibly damaging 0.708 01/23/2020
45 616917 UTSW Vps54 0.927 R8011 G1 225.01 Y 11 21275095 R197L G T missense Het probably damaging 0.990 0.116 phenotype 01/23/2020
46 616912 UTSW Xkr5 0.000 R8011 G1 225.01 Y 8 18948720 Y27* G T nonsense Het probably null 01/23/2020
47 616908 UTSW Zfp626 0.069 R8011 G1 225.01 Y 7 27818715 C374S T A missense Het possibly damaging 0.851 0.734 01/23/2020
[records 1 to 47 of 47]